Difference between revisions of "Part:BBa K4441000"

Revision as of 04:19, 12 October 2022

BRAF WT F3

Sequence used in wetlab experiments: CCACAGAGACCTCAAGAGT is taken from [1]

Usage and Biology

This is the sequence for the outer forward primer. The outer forward primer complementary to the F3c region of the template sequence [2]. Outer primer F3 hybridizes to the F3c region of the target DNA and extends, displacing the FIP linked complementary strand[2]. This displaced strand forms a loop at the 5' end primer is shorter in length and lower in concentration than FIP (forward inner primer) [2]. This F3 primer is part of the primer set that detects the WT BRAF: TTACTTACACGCCAAGTCAATCATCCACAGAGACCTCAAGAGTAATAATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGCATTTGGAATTGTTCTGTATGAATTGATGACTGGACAGTTACCTTATTCAAACATCAACAACAGGGACCAG

Dilutions: Storage Primer Concentration: 100 μM 10X Concentration (Stock): 16 μM Volume of 10X primer mix: 10 μL 1X Concentration (Final):1.6 μM Volume of storage primer needed: 1.6 μL Mixed with B3, FIP, BIP for a total of 3.6 μL -- Final primer mix 1 μL of final primer mix is used in the LAMP reaction mix. For more information, visit https://2022.igem.org/Team:Washington

Citations

1. Du, Y., Pothukuchy, A., Gollihar, J. D., Nourani, A., Li, B., & Ellington, A. D. (2017). Coupling sensitive nucleic acid amplification with commercial pregnancy test strips. Angewandte Chemie International Edition, 56(4), 992-996. 2. Loop mediated isothermal amplification - technote. (n.d.). Retrieved October 11, 2022, from http://www.premierbiosoft.com/tech_notes/Loop-Mediated-Isothermal-Amplification.html

Sequence and Features