Difference between revisions of "Part:BBa K4221005"

Revision as of 08:09, 11 October 2022

mHoneydew

Sequence and Features

Usage

Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.

Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using mHoneydew[2] as target protein can visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.

Biology

Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]

Design Consideration

The construct was cloned into a PET28a plasmid and transformed into mHoneydew-PET28a [2]

The construction includes:

mHoneydew is fused with BslA with a GS linker（GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT） and TEVlinker（GAAAACCTGTACTTCCAGGGTTCTGGT）

Protein Expression

We transformed recombinant plasmids (pET28a-mHoneydew-GSlinker-BslA) into BL21 and Rosetta expressing strains.

Figure 1.(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG (b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure 2.(a) SDS-PAGE of pET28a-mHoneydew-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG (b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Detection of fusion protein function

After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant (use 1×PBS as buffer). In order to verify that the fusion protein (mOrange-GSlinker-BslA) was successfully fused and expressed compared to the control group (mOrange). We attempted to conduct water contact angle experiments. Due to experimental conditions, we cannot use professional instruments. We used parafilm as the substrate, which is an extremely hydrophobic interface, and added droplets of the supernatant of the control group and the supernatant of the fusion protein experimental group respectively for observation. We found that the contact angle of the control group was much smaller than that of the experimental group. This means that the supernatant of the control group was hydrophobic as a whole, while the experimental group was hydrophilic. BslA, as a hydrophobin, has the characteristic of reversing surface properties. Through this experiment, we can prove the existence of BslA in the experimental group.

Figure 3.Water contact angle.

Aqueous two-phase separation (ATPS) Testing

We used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.

Figure 4. ATPS testing.

Reference

[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)

[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.

[3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.