Difference between revisions of "Part:BBa K4221018"
| Line 15: | Line 15: | ||
===Usage=== | ===Usage=== | ||
Near-infrared (NIR) fluorescent probes have become powerful tools for non-invasive monitoring of various biologically important processes in vivo. To meet the requirement of improving the function of NIR, one has to find a material that can render NIR fluorescent probes soluble and selective simultaneously.the hybrid hydrophobin-RGD fusion protein preserving dual abilities can render NIR fluorescent probes soluble and selective simultaneously. Our team is trying to improve self-assembly and targeting functions from HFBI and RGD peptideand replacing HFBI with BslA.[2] | Near-infrared (NIR) fluorescent probes have become powerful tools for non-invasive monitoring of various biologically important processes in vivo. To meet the requirement of improving the function of NIR, one has to find a material that can render NIR fluorescent probes soluble and selective simultaneously.the hybrid hydrophobin-RGD fusion protein preserving dual abilities can render NIR fluorescent probes soluble and selective simultaneously. Our team is trying to improve self-assembly and targeting functions from HFBI and RGD peptideand replacing HFBI with BslA.[2] | ||
| − | |||
| − | |||
===Biology=== | ===Biology=== | ||
| Line 25: | Line 23: | ||
===Design Consideration=== | ===Design Consideration=== | ||
| − | The construct was cloned into a PET28a plasmid and transformed into | + | The construct was cloned into a PET28a plasmid and transformed into BL21 (DE3) E. coli. |
The construction includes: | The construction includes: | ||
Latest revision as of 06:45, 11 October 2022
RGD-GSlinker-BslA(42-181aa)
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Usage
Near-infrared (NIR) fluorescent probes have become powerful tools for non-invasive monitoring of various biologically important processes in vivo. To meet the requirement of improving the function of NIR, one has to find a material that can render NIR fluorescent probes soluble and selective simultaneously.the hybrid hydrophobin-RGD fusion protein preserving dual abilities can render NIR fluorescent probes soluble and selective simultaneously. Our team is trying to improve self-assembly and targeting functions from HFBI and RGD peptideand replacing HFBI with BslA.[2]
Biology
RGD is a tripeptide sequence containing arginine-glycine-aspartate, which is a recognition site for the interaction between integrins and their ligands. It mediates the adhesion between cells and extracellular matrix and between cells, and has signal transduction function, thereby mediating many important life activities.[1]
BslA is a structurally defined bacterial hydrophobin that was found in the biofilm of Bacillus subtilis. It helps the assembling of TasA (an exopolysaccharide and an amyloid fiber-forming protein), the component of the biofilm matrix. BslA is composed of an Ig-type fold with the addition of an unusual, extremely hydrophobic “cap” region. The central hydrophobic residues of the cap are essential to allow a hydrophobic, nonwetting biofilm to form as they control the surface activity of the BslA protein.[4]
Design Consideration
The construct was cloned into a PET28a plasmid and transformed into BL21 (DE3) E. coli.
The construction includes: RGD is fused with BslA with a GS linker（GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT）
Reference
[1]Qu Hong, WangXiangcheng, Wang Cheng, etal. Research progress and clinical application of RGD peptide[J]. Journal Of Inner Mongolia Medical University, 2019, 41(6):660-663.
[2]Xiao Y, Zhang Q, Wang Y. Dual-functional protein for one-step production of a soluble and targeted fluorescent dye[J]. Theranostics, 2018, 8(11):3111-3125.
[3] Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
[4]: “BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm.” Proceedings of the National Academy of Sciences of the United States of America vol. 110,33 (2013): 13600-5. doi:10.1073/pnas.1306390110