Difference between revisions of "Part:BBa K4221017"

Latest revision as of 06:44, 11 October 2022

LL37-GSlinker-BslA(42-181aa)

Sequence and Features

Usage

The search for new approaches for developing antimicrobial surfaces is a challenge of great urgency to prevent and control microbial growth on surfaces. Our team design of a new, simple and general tool for creating antimicrobial surfaces, based on use a hydrophobin protein BslA to replaced the hydrophobin Vmh2 from Pleurotusostreatus to the human antimicrobial peptide

Our team used the amphiphilicity of BslA to enhance the antibacterial/targeting effect of LL37 antimicrobial peptide

Biology

LL-37 is a C-terminal cleavage product of Cathelicidin peptide HCAP-18, which can directly kill bacteria, fungi and viruses.

BslA is a structurally defined bacterial hydrophobin that was found in the biofilm of Bacillus subtilis. It helps the assembling of TasA (an exopolysaccharide and an amyloid fiber-forming protein), the component of the biofilm matrix. BslA is composed of an Ig-type fold with the addition of an unusual, extremely hydrophobic “cap” region. The central hydrophobic residues of the cap are essential to allow a hydrophobic, nonwetting biofilm to form as they control the surface activity of the BslA protein.[2]

Design Consideration

The construction includes:

LL37 is fused with BslA with a GS linker（GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT）

Reference

[1]I. Sorrentino, M. Gargano, A. Ricciardelli, et al., Developmentof anti-bacterial surfaces using a hydrophobin chimeric protein, International Journal ofBiological Macromolecules (2018)

[2]: “BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm.” Proceedings of the National Academy of Sciences of the United States of America vol. 110,33 (2013): 13600-5. doi:10.1073/pnas.1306390110