Difference between revisions of "Part:BBa K4221011"

Latest revision as of 06:42, 11 October 2022

EGFP-GSlinker-BslA(42-181aa)

Sequence and Features

Usage

Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.

Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using EGFP[2] as target protein can visually observe fluorescent protein (EGFP,target protein) showing green fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.

In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.

Biology

Green fluorescent protein (GFP)[3] was originally identified from the jellyfish (Aequorea victoria). When the jellyfish luminescent protein binds Ca2+, it emits blue fluorescence, which is further excited to produce green fluorescence，in order to improve the detection sensitivity of Reporter gene, Guohong et al. replaced Ser65 with Thr and Phe64 with Leu, which increased the fluorescence intensity of EGFP by 35 times compared with GFP.

BslA is a structurally defined bacterial hydrophobin that was found in the biofilm of Bacillus subtilis. It helps the assembling of TasA (an exopolysaccharide and an amyloid fiber-forming protein), the component of the biofilm matrix. BslA is composed of an Ig-type fold with the addition of an unusual, extremely hydrophobic “cap” region. The central hydrophobic residues of the cap are essential to allow a hydrophobic, nonwetting biofilm to form as they control the surface activity of the BslA protein.[4]

Design Consideration

The construct was cloned into a PET28a plasmid and transformed into BL21 (DE3) E. coli.

The construction includes:

The CT fused with BslA with a GS linker（GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT）

Reference

[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)

[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.

[3]J.Ma Green fluorescent protein[J](in Chinese). Chemistry, 2009(3):243-250.

[4]: “BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm.” Proceedings of the National Academy of Sciences of the United States of America vol. 110,33 (2013): 13600-5. doi:10.1073/pnas.1306390110