Difference between revisions of "Part:BBa K4221002"
(→Aqueous two-phase separation (ATPS) Testing) |
(→Usage) |
||
Line 15: | Line 15: | ||
===Usage=== | ===Usage=== | ||
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants. | Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants. | ||
+ | |||
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. | Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. | ||
− | Using EBFP[2] as target | + | Using EBFP[2] as target protein can visually observe fluorescent protein (EBFP,target protein) showing blue fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect. |
===Biology=== | ===Biology=== |
Revision as of 15:40, 10 October 2022
EBFP
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Usage
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using EBFP[2] as target protein can visually observe fluorescent protein (EBFP,target protein) showing blue fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
Biology
Blue fluorescent protein (BFP)[3] was mutant of GFP which originally identified from the jellyfish (Aequorea victoria). Design Consideration: The construct was cloned into a PET28a plasmid and transformed into EBFP-PET28a [2] The construction includes: EBFP is fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT) and TEVlinker(GAAAACCTGTACTTCCAGGGTTCTGGT)
Detection of fusion protein function
After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant, We used a comparative experiment to add different droplets to the hydrophobic material and observe the water contact Angle.
Aqueous two-phase separation (ATPS) Testing
We used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.
Reference
[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
[3]PapadakiStavrini; Xinyue Wang; Yangdong Wang. Etc. Dual-expression system for blue fluorescent protein optimization.[J]. Scientific reports, 2022(3).