Difference between revisions of "Part:BBa K4221009"
Line 15: Line 15:
 
===Usage===
 
===Usage===
 
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
 
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
−
 
 
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA.
 
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA.
−
Using EGFP[2] as target proteincan visually observe fluorescent protein (EGFP,target protein) showing green fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
+
Using EBFP[2] as target proteincan visually observe fluorescent protein (EBFP,target protein) showing blue fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
  
 
In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.
 
In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.
  
 
===Biology===
 
===Biology===
−
Green fluorescent protein (GFP)[3] was originally identified from the jellyfish (Aequorea victoria). When the jellyfish luminescent protein binds Ca2+, it emits blue fluorescence, which is further excited to produce green fluorescence，in order to improve the detection sensitivity of Reporter gene, Guohong et al. replaced Ser65 with Thr and Phe64 with Leu, which increased the fluorescence intensity of EGFP by 35 times compared with GFP.
+
Blue fluorescent protein (BFP)[3] was mutant of GFP which originally identified from the jellyfish (Aequorea victoria).  
 +
Design Consideration:
 +
The construct was cloned into a PET28a plasmid and transformed into EBFP-PET28a [2]
 +
The construction includes:
 +
EBFP is fused with BslA with a GS linker（GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT）
  
−
BslA is a structurally defined bacterial hydrophobin that was found in the biofilm of Bacillus subtilis.
+
===Protein Expression===
−
It helps the assembling of TasA (an exopolysaccharide and an amyloid fiber-forming protein), the component of the biofilm matrix. BslA is composed of an Ig-type fold with the addition of an unusual, extremely hydrophobic “cap” region. The central hydrophobic residues of the cap are essential to allow a hydrophobic, nonwetting biofilm to form as they control the surface activity of the BslA protein.[4]
+
  
−
===Design Consideration===  
+
[[File:figure-2 a .png|500px]]<br>
−
The construct was cloned into a PET28a plasmid and transformed into EGFP-PET28a [2]
+
'''Figure 1.'''
−
The construction includes:
+
 
−
EGFP is fused with BslA with a GS linker（GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT）
+
(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 +
 
 +
[[File:figure-2 b .png|500px]]<br>
 +
 
 +
'''Figure 1.'''
 +
 
 +
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
 +
 
 +
[[File:figure-3 a .png|500px]]<br>
 +
 
 +
'''Figure 2.'''
 +
 
 +
(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG
 +
 
 +
[[File:figure-3 b .png|500px]]<br>
 +
 
 +
'''Figure 2.'''
 +
 
 +
(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,
 +
 
 +
===Detection of fusion protein function===
 +
After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant, We used a comparative experiment to add different droplets to the hydrophobic material and observe the water contact Angle.
 +
 
 +
[[File:figure-8 .png|500px]]<br>
 +
'''Figure 3.'''Water contact angle.
 +
 
 +
===Aqueous two-phase separation (ATPS) Testing===
 +
We used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.
 +
 
 +
[[File:figure-9 a .png|500px]]<br>
 +
'''Figure 4.''' ATPS testing.
  
 
===Reference===
 
===Reference===
Line 37: Line 69:
 
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
 
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
  
−
[3]J.Ma Green fluorescent protein[J](in Chinese). Chemistry, 2009(3):243-250.
+
[3]PapadakiStavrini; Xinyue Wang; Yangdong Wang. Etc. Dual-expression system for blue fluorescent protein optimization.[J]. Scientific reports, 2022(3).
−
 
+
−
[4]: “BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm.” Proceedings of the National Academy of Sciences of the United States of America vol. 110,33 (2013): 13600-5. doi:10.1073/pnas.1306390110
+
  
  

Revision as of 13:11, 10 October 2022


EBFP-GSlinker-BslA(42-181aa)



Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Usage

Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants. Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using EBFP[2] as target proteincan visually observe fluorescent protein (EBFP,target protein) showing blue fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.

In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.

Biology

Blue fluorescent protein (BFP)[3] was mutant of GFP which originally identified from the jellyfish (Aequorea victoria). Design Consideration: The construct was cloned into a PET28a plasmid and transformed into EBFP-PET28a [2] The construction includes: EBFP is fused with BslA with a GS linker（GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT）

Protein Expression

Figure-2 a .png
Figure 1.

(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-2 b .png

Figure 1.

(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Figure-3 a .png

Figure 2.

(a) SDS-PAGE of pET28a-EBFP-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12hM: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-3 b .png

Figure 2.

(b) Strain after induction. 1: 37℃ 0.1mM IPTG, 2: 37℃ 0.3mM IPTG, 3: 37℃ 0.5mM IPTG, 4: 16℃ 0.1mM IPTG, 5: 16℃ 0.3mM IPTG, 6: 16℃ 0.5mM IPTG,

Detection of fusion protein function

After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant, We used a comparative experiment to add different droplets to the hydrophobic material and observe the water contact Angle.

Figure-8 .png
Figure 3.Water contact angle.

Aqueous two-phase separation (ATPS) Testing

We used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.

Figure-9 a .png
Figure 4. ATPS testing.

Reference

[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)

[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.

[3]PapadakiStavrini; Xinyue Wang; Yangdong Wang. Etc. Dual-expression system for blue fluorescent protein optimization.[J]. Scientific reports, 2022(3).