In the last few years, much attention has been drawn to emerging contaminants due to their severe effects on human health and the lack of information about them. Among them, erythromycin has risen as a potential threat in developing antimicrobial resistance. Being capable of detecting this component and its variations in water bodies can lead to the creation of measurement methods capable of degrading them.

In our project, erythromycin C-12 hydroxylase (EC 1.14.13.154) is used as a detector for the presence of erythromycin by catalyzing the oxidation of two stereoisomers of erythromycin, erythromycin B and D to erythromycin C. As shown in Figure 1, this reaction requires NADPH as a reagent and, therefore, gives NADP+ as a reaction product. Consequently, it is possible to evaluate the presence of erythromycin through a coupled reaction employing a NADP+/NADPH colorimetric assay.

Figure 1. Chemical reaction for erythromycin C-12 hydroxylase (EryK).

Figure 2. Three-dimensional structure of EryK.

Erythromycin C-12 hydroxylase, as pictured below in Figure 2, is a monomer with 397 amino acids in length and 43.8 kDa in weight. According to Savino et al. (2009), it binds one heme b(iron(II)-protoporphyrin IX) group per subunit as a cofactor. Lambalot et al. (1995) reported a Michaelis constant of 8 μM for erythromycin D, concluding that it shows a 1200-1900-fold preference for erythromycin D over the alternative substrate erythromycin B. This enzyme participates in various molecular and biological processes, ranging from macrolide biosynthetic processes to oxidoreductase reactions.

Characterization

PCR amplification from BBa_K4447004

Originally, BBa_K4447001 was located in our FRET expression system (BBa_K4447004). For instance, it had to be amplified through end-point PCR. Primers for amplification are shown below:

Figure 3. Amplification of EryK through end-point PCR. Lane 1 represents 1kb DNA Ladder from Promega. Lane 2 represents end-point PCR for EryK.

• Forward primer: 5' - CGTACCATGGCCGACGAAACCGC - 3'
• Reverse primer: 5' - TAGCGAATTCCTAATGATGATGATGATGATGCGCCGACTGCCTCGGCG - 3'

Forward primer contains a restriction site for the NcoI restriction enzyme, while reverse primer contains a gly-gly-ser spacer, a polyhistidine tag, a stop codon, and a restriction site for the EcoRI restriction enzyme. PCR conditions are shown in Table 1.

Finally, results from the PCR are shown in Figure 3. After successfully purifying the fragment from an agarose gel, the concentration obtained was 96.5 ng/µL in 40 µL dilution. With the fragment already purified, we proceeded to perform ligation with pBAD/Myc-HisB plasmid.

Restriction Enzyme Digestion and Ligation

We performed a restriction enzyme digestion with EryK already purified and the vector defined. Our digestion involved using NcoI and EcoRI restriction enzymes. For both vector and insert, DNA concentration was stated as 4000 nanograms. Table 2 displays the protocol followed for a 50 µL reaction.

Finally, colonies were succesfully ligated into pBAD/Myc-HisB. Ligations conditions were at 25 degrees for one hour, at a rate of 1:7 respectivelly. For instance, we performed bacterial transformation in Escherichia coli BL21 strain for subsequent protein expression.

References

[1]. Lambalot, R. H., Cane, D. E., Aparicio, J. J., & Katz, L. (1995). Overproduction and characterization of the erythromycin C-12 hydroxylase, EryK. Biochemistry, 34(6), 1858–1866. https://doi.org/10.1021/bi00006a006

[2]. Mirdita, M., Schütze, K., Moriwaki, Y. et al.(2022). ColabFold: making protein folding accessible to all. Nat Methods 19, 679–682. https://doi.org/10.1038/s41592-022-01488-1

[3]. Savino, C., Montemiglio, L. C., Sciara, G., Miele, A. E., Kendrew, S. G., Jemth, P., Gianni, S., & Vallone, B. (2009). Investigating the structural plasticity of a cytochrome P450: three-dimensional structures of P450 EryK and binding to its physiological substrate. The Journal of biological chemistry, 284(42), 29170–29179. https://doi.org/10.1074/jbc.M109.003590