Difference between revisions of "Part:BBa K3320008"
Marshalliu (Talk | contribs) |
Marshalliu (Talk | contribs) |
||
| Line 32: | Line 32: | ||
<br>1. de Felippes, F., McHale, M., Doran, R. L., Roden, S., Eamens, A. L., Finnegan, E. J., & Waterhouse, P. M. (2020). The key role of terminators on the expression and post‐transcriptional gene silencing of Transgenes. The Plant Journal, 104(1), 96–112. https://doi.org/10.1111/tpj.14907 | <br>1. de Felippes, F., McHale, M., Doran, R. L., Roden, S., Eamens, A. L., Finnegan, E. J., & Waterhouse, P. M. (2020). The key role of terminators on the expression and post‐transcriptional gene silencing of Transgenes. The Plant Journal, 104(1), 96–112. https://doi.org/10.1111/tpj.14907 | ||
<br>2. Chen, Y.-J., Liu, P., Nielsen, A. A., Brophy, J. A., Clancy, K., Peterson, T., & Voigt, C. A. (2013). Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods, 10(7), 659–664. https://doi.org/10.1038/nmeth.2515 | <br>2. Chen, Y.-J., Liu, P., Nielsen, A. A., Brophy, J. A., Clancy, K., Peterson, T., & Voigt, C. A. (2013). Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods, 10(7), 659–664. https://doi.org/10.1038/nmeth.2515 | ||
| − | <br>3. Cao, H., & Kuipers, O. P. (2018). Influence of global gene regulatory networks on single cell heterogeneity of green fluorescent protein production in bacillus subtilis. Microbial Cell Factories, 17(1). https://doi.org/10.1186/s12934-018-0985-9 | + | <br>3. Cao, H., & Kuipers, O. P. (2018). Influence of global gene regulatory networks on single cell heterogeneity of green fluorescent protein production in bacillus subtilis. Microbial Cell Factories, 17(1). https://doi.org/10.1186/s12934-018-0985-9 |
===Functional Parameters=== | ===Functional Parameters=== | ||
<partinfo>BBa_K3320008 parameters</partinfo> | <partinfo>BBa_K3320008 parameters</partinfo> | ||
Revision as of 00:49, 9 October 2022
|
|
ECK120015170 terminator
|
Secondary Structure
Team: BNDS_China 2022 data and characterization method from literature review
Characterization data
The ECK120015170 terminator is a very strong terminator. A strong terminator can enhance the protein expression which may help other iGEM teams increase protein expression efficiency in their projects. The strength of the ECK120015170 can be reflected by the ratio of the expression level of two fluorescent proteins: GFP and RFP.
The source organism is E.coli. The genomic sequence is ACAATTTTCGAAAAAACCCGCTTCGGCGGGTTTTTTTATAGCTAAAA
This terminator is contained in a constructed plasmid. The arabinose-induced GFP expression plasmid—pGR-ECK120015170—which contains araC, araBAD promoter, RBS, GFP, ECK120015170 terminator and RFP was used to characterize terminator ECK120015170. The GFP gene is set upstream and RFP is placed downstream of the ECK120015170 terminator.
Quantitative Characterization
The average GFP intensity under the treatment of arabinose is 15714.00, and the average RFP intensity under the treatment of arabinose is 141.53. According to this method, the terminator strength (Ts) of ECK120015170 is 99.59 which corresponds to a high terminator strength.
Reference
1. de Felippes, F., McHale, M., Doran, R. L., Roden, S., Eamens, A. L., Finnegan, E. J., & Waterhouse, P. M. (2020). The key role of terminators on the expression and post‐transcriptional gene silencing of Transgenes. The Plant Journal, 104(1), 96–112. https://doi.org/10.1111/tpj.14907
2. Chen, Y.-J., Liu, P., Nielsen, A. A., Brophy, J. A., Clancy, K., Peterson, T., & Voigt, C. A. (2013). Characterization of 582 natural and synthetic terminators and quantification of their design constraints. Nature Methods, 10(7), 659–664. https://doi.org/10.1038/nmeth.2515
3. Cao, H., & Kuipers, O. P. (2018). Influence of global gene regulatory networks on single cell heterogeneity of green fluorescent protein production in bacillus subtilis. Microbial Cell Factories, 17(1). https://doi.org/10.1186/s12934-018-0985-9