Difference between revisions of "Part:BBa K4197021"

Revision as of 22:30, 8 October 2022

Ana o 3 expression at the surface of E. coli cells sortable by FACS using mSCARLET-I

Introduction

The mScarlet-I fluorescent reporter has been added on the plasmid allowing to express the gene of cashew nut Ana o 3 (K4197007) on the surface of E. coli. Expression of mScarlet-I is driven by the ihfb800 promoter (see K41970022). This red fluorescence is destined to identify the allergen expressing cells by FACS.

The part expressing the gene of cashew nut Ana o 3 (K4197007) has been completed with the ihfb800-mScarlet construction (K41970022) to express red fluorescence. This red fluorescence allows sorting of bacteria by FACS.

Construction

The ihfb800-mScarlet construction was amplified by PCR with the high-fidelity Phusion polymerase using IF3_mSCARLET-I F (ttatttgtacagttcatccataccacc) and IF4_mSCARLET-I R (atggtttctaaaggtgaagcagtg) primers. The expected size of the amplicon is 699 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ana o 3 (K4197007) by In-Fusion.

The resulting products were transformed into Stellar cells and positive transformants were selected. The correct sequence was further assessed by sequencing.

Validation

Successful colonies have shown pink coloring even without excitation light indicating the expression of the mScarlet-I, thus validating the mScarlet-I addition to the construction and its correct expression driven by the ihfB promoter (Figure 1).

Figure 1: Second plating of pET-21 b (+)_Ara h 2_OmpA_mScarlet-I transformed cells and pET-21 b (+)_Ana o 3_OmpA_mScarlet-I transformed Stellar cells. The colonies were selected on LB-ampicillin plates.

DAISY PROJECT

1. DAISY (INSA-UPS 2022)

Sequence and Features