Difference between revisions of "Part:BBa K4197002"
Line 8: Line 8:
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>The part expressing the gene of The part expressing the gene of of dust mite Gal d 2 (<a href="https://parts.igem.org/Part:BBa_K4197006">K4197006</a>) has been completed with the ihfb800-RFP
 +
construction (<a href="https://parts.igem.org/Part:BBa_K41970012">K41970012</a>) to express red fluorescence. This red fluorescence allows sorting of bacteria by FACS.
 +
</p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p>
+
<p>The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R
−
   
+
(cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622
 +
bp. </p>
 +
<p>We were not able to linearize the plasmid containing the gene of dust mite (<a href="https://parts.igem.org/Part:BBa_K4197006">K4197006</a>).</p>
  
−
<div class="center">
 
−
        <div class="thumb tnone">
 
−
            <div class="thumbinner" style="width:50%;">
 
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image">
 
−
                    <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                    <div class="magnify">
 
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
 
−
                    </div>
 
−
                    <b>Figure 1: </b> <b>Xxxxxx</b> 
 
−
                  Xxxxxxxxxxxxxxxxxxxxxxxxxxx.
 
−
                </div>
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
<h2>Xxxxxxxxx</h2>
 
−
<p>Xxxxxxxxxxxxx</p>
 
−
<div class="center">
 
−
    <div class="thumb tnone">
 
−
        <div class="thumbinner" style="width:80%;">
 
−
            <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image">
 
−
                <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
−
                <div class="magnify">
 
−
                    <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a>
 
−
                </div>
 
−
                <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> 
 
−
                Xxxxxxxxxxxxx.
 
−
            </div>
 
−
        </div>
 
−
    </div>
 
−
</div>
 
−
   
 
−
<h2>titre 2</h2>
 
−
<h3>Titre 3</h3>
 
−
<p>Xxxxxxxxxx</p>
 
−
<ul>
 
−
    <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li>
 
−
    <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li>
 
−
</ul>
 
−
<p>Xxxxxxxxxx</p>
 
−
<ul>
 
−
    <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li>
 
−
    <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li>
 
−
</ul>
 
−
 
−
 
−
<h3>titre 3</h3>
 
−
    <h4>Titre 4</h4>
 
−
<p>Xxxxxx</p>
 
−
 
−
                 
 
−
<h4>Titre 4</h4>
 
−
<p>xxxxxxx</p>
 
−
 
−
<h2>Titre 2</h2>
 
−
<p>Xxxxxx</p>
 
 
<h2>References</h2>
 
<h2>References</h2>
 
<ol>
 
<ol>
−
    <i>
+
<li> <a href="https://parts.igem.org/Part:BBa_K4197009">K4197009</a> </li>
−
    <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li>
+
<li> <a href="https://parts.igem.org/Part:BBa_K4197012">K4197012</a> </li>
−
    <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li>
+
<li> <a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </li>
−
    <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
−
</i>
+
 
</ol>
 
</ol>
 +
 +
 
</html>
 
</html>
  
Line 84: Line 33:
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
−
<partinfo>BBa_K4197002 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K4197003 SequenceAndFeatures</partinfo>
  
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
−
<partinfo>BBa_K4197002 parameters</partinfo>
+
<partinfo>BBa_K4197003 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Revision as of 18:11, 8 October 2022


Der p 1 expression at the surface of E. coli cells sortable by FACS cells using mRFP1

Brick expressing Der p 1 at the surface of E. coli cell sortable by FACS

Introduction

The part expressing the gene of The part expressing the gene of of dust mite Gal d 2 (K4197006) has been completed with the ihfb800-RFP construction (K41970012) to express red fluorescence. This red fluorescence allows sorting of bacteria by FACS.

Construction

The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R (cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622 bp.

We were not able to linearize the plasmid containing the gene of dust mite (K4197006).

References

  1. K4197009
  2. K4197012
  3. DAISY (INSA-UPS 2022)

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal NheI site found at 1703
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal NotI site found at 1519
    Illegal NotI site found at 2697
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal BglII site found at 1592
    Illegal BamHI site found at 1735
    Illegal XhoI site found at 2706
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
    Illegal AgeI site found at 1360
    Illegal AgeI site found at 1472
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 2368