Difference between revisions of "Part:BBa K4197010"

Revision as of 18:01, 8 October 2022

_NOTOC__ OmpA_DARPin_sfGFP fusion

Gene fusion to express the DARPin-sfGFP fusion protein at the surface of E.coli.

Introduction

This part is composed of the gene coding for the DARPin E2_79 protein. This synthetic protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was linked to a sfGFP protein. This was merged to the membrane protein OmpA of E. coli (BBa_K1694002) to display the DARPin on the surface of E. coli. This lipoprotein is the most abundant in yhe membrane of E. coli with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016). The fusion protein is described in Part: BBa_K4197011. The sfGFP will be used as a reporter to prove that the fusion protein is expressed at the surface of the membrane. h

Construction

The fusion protein OmpA_DARPin_sfGFP was expressed in the pET-21 b (+) plasmid. As explained in Part BBa_K4197011, two versions of the fusion protein were built, as the first one presented a missing DNA fragment (more details in the corresponding part). OmpA_DARPin-sfGFP fragment from IDT was amplified by PCR using the high fidelity Phusion DNA polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. The expected size of the amplicon was 1468 bp.

Figure 1: Figure 18: OmpA_DARPin-sfGFP fragment amplified by PCR. The expected size of the amplicon was 1468 bp. The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gel. (note that a different ladder is presented on the theoretical gel).

Xxxxxxxxx

Xxxxxxxxxxxxx

Figure 2: Xxxxxxxxxxxxx Xxxxxxxxxxxxx.

titre 2

Titre 3

Xxxxxxxxxx

• Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
• Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG

Xxxxxxxxxx

• CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
• Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG

titre 3

Titre 4

Xxxxxx

Titre 4

xxxxxxx

Titre 2

Xxxxxx

References

1. Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
2. Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
3. Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.

Sequence and Features