Difference between revisions of "Part:BBa K4197007"
Line 1: Line 1:
  
 
__NOTOC__
 
__NOTOC__
−
<partinfo>BBa_K4197007 short</partinfo>
+
<partinfo>BBa_K4197003 short</partinfo>
  
−
Gene fusion to express the cashew allergen Ana o 3 on the surface of <i>E. coli</i>.
+
Brick expressing Ana o 3 at the surface of E. coli cell sortable by FACS
  
 
<html>
 
<html>
  
 
<h2>Introduction</h2>
 
<h2>Introduction</h2>
−
<p>This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: <a "https://www.ncbi.nlm.nih.gov/protein/AAL91665.1/">AAL91665.1</a>). The cashew allergy prevalence is higher than 0,08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy  (Sato and al. 2019). Ana o 3 have already been expressed in <i>E. coli </i>and was able to bind the IgE of patient with cashew's allergie (Robotham and al. 2005). Ana o 3 was merged to the membrane protein OmpA of <i>E. coli </i> (<a href="https://parts.igem.org/Part:BBa_K1694002">BBa_K1694002</a>), to display Ana o 3 on the surface of <i>E. coli</i>. This lipoprotein is the most abundant in <i>E. coli's </i>membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016). </p>
+
<p>The part expressing the gene of cashew nut Ana o 3 (<a href="https://parts.igem.org/Part:BBa_K4197007">K4197007</a>) has been completed with the ihfb800-RFP construction
−
 
+
(<a href="https://parts.igem.org/Part:BBa_K41970012">K41970012</a>) to express red
−
 
+
fluorescence. This red fluorescence allows sorting of bacteria by FACS. </p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
 
+
<p>The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R
−
<p>Ana o 3 gene ordered on IDT  was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen F and IF4 Ana o 3. Expected size of the amplicon was  479 bp.</p>
+
(cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622
−
 
+
bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ana o 3 (<a href="https://parts.igem.org/Part:BBa_K4197007">K4197007</a>) by In-Fusion. </p>
−
<p>Amplification product sizes were checked on Ethidium bromide stained agarose gel (Figure 1).</p>  
+
<p>The resulting products were transformed into Stellar cells and transformants were selected. Colonies were screened by PCR using screening_insert_R
 +
(ccgaaacaagcgctcatgagc) and screening_insert_F (ggttatgctagttattgctcagc) primers. The expected sizes of amplicons was 2944 bp with RFP and 1453 bp without RFP.</p>
 +
   
  
 
<div class="center">
 
<div class="center">
−
    <div class="thumb tnone">
+
        <div class="thumb tnone">
−
        <div class="thumbinner" style="width:80%;">
+
            <div class="thumbinner" style="width:50%;">
−
            <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-fragment.png" class="image">
+
                <a href="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-check.png" class="image">
−
                <img alt="" src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-fragment.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
                    <img alt="" src="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-check.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
−
                <div class="magnify">
+
                    <div class="magnify">
−
                    <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-fragment.png" class="internal" title="Enlarge"></a>
+
                        <a href="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-check.png" class="internal" title="Enlarge"></a>
 +
                    </div>
 +
                    <b>Figure 1: </b> <b>Verification of the insertion of RFP fragment in Ana o 3 with gel.</b> 
 +
The PCR screening was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the
 +
NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colony 8 has shown the
 +
right size.
 
                 </div>
 
                 </div>
−
                <<i><b>Figure 1: Ana o 3 amplified fragment. Expected size of the amplicons was 479 bp.</b> PCR amplicon sizes Ana o 3 were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i> 
 
−
               
 
 
             </div>
 
             </div>
 
         </div>
 
         </div>
 
     </div>
 
     </div>
−
</div>
+
−
 
+
−
<p>The products matched expected sizes and amplicons were further purified from the gel.</p>
+
<h2>Validation</h2>
−
 
+
<p>Successful colonies were further tested by digestion with NotI which cut both in the plasmid and in the mRFP1 gene (Figure 2). Correct sizes were expected to be
−
<p> To merge Ana o 3 to OmpA, the gene was  inserted in a pET-21 b (+) plasmid containing OmpA merged to Gal d 2, another allergen. The plasmid was linearized, excluding the Gal d 2 fragment by PCR. The primers used were IF1_allergen (gctctgaaaatacaggttttcactg)and IF2_plasmid (ttaaagcttgcggccgcactcg). Expected size of the amplicon was 5924 bp.</p>
+
1178 and 6791 bp for Ara h 2.</p>
−
 
+
−
<p>Amplification product sizes were checked on thidium bromide stained agarose gel (Figure 2).</p>
+
−
 
+
−
 
+
−
 
+
 
<div class="center">
 
<div class="center">
 
     <div class="thumb tnone">
 
     <div class="thumb tnone">
 
         <div class="thumbinner" style="width:80%;">
 
         <div class="thumbinner" style="width:80%;">
−
             <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/pet-21-b-linearized-and-ara-h-2-fragment.png" class="image">
+
             <a href="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-dig.png" class="image">
−
                 <img alt="" src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/pet-21-b-linearized-and-ara-h-2-fragment.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
                 <img alt="" src="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-dig.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
 
                 <div class="magnify">
 
                 <div class="magnify">
−
                     <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/pet-21-b-linearized-and-ara-h-2-fragment.png" class="internal" title="Enlarge"></a>
+
                     <a href="https://static.igem.wiki/teams/4197/wiki/parts/raph/anao3-dig.png" class="internal" title="Enlarge"></a>
 
                 </div>
 
                 </div>
−
                 <i><b>Figure 2: pET-21 b (+)_OmpA linearized with Gal d 2 exclusion (A) and Ara h 2 amplified fragment (B). Expected sizes of the amplicons were 5924 bp (A) and 567 bp (B).</b> PCR amplicon sizes of pET-21 b (+)_OmpA (A) and Ara h 2 (B) were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i> 
+
                 <b>Figure 2: </b> <b>Digestion by NotI of Ana o 3 with mRFP1 insertion.</b>
−
               
+
                The digestion product was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the  
 +
NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). colonies 21 and 23 present
 +
the correct size for Ana o 3.
 
             </div>
 
             </div>
 
         </div>
 
         </div>
Line 56: Line 58:
 
</div>
 
</div>
  
−
 
+
<p>This construction has not shown red fluorescence on the microscope. After sequencing, a mutation has been revealed on the mRFP sequence which does not allow us
−
 
+
to continue further with this construction.</p>
−
<p>In-Fusion assemby reaction was performed to insert Ana o 3 in the plasmid and transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone (primers used: screening_inserts-F:ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc). 4 positive transformants were detected (Figure 3).</p>
+
−
 
+
−
 
+
−
 
+
−
<div class="center">
+
−
    <div class="thumb tnone">
+
−
        <div class="thumbinner" style="width:80%;">
+
−
            <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-screening.png" class="image">
+
−
                <img alt="" src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-screening.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                <div class="magnify">
+
−
                    <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-screening.png" class="internal" title="Enlarge"></a>
+
−
                </div>
+
−
                <i><b>Figure 3: pET21 b (+)_OmpA_Ana o 3 construction fragments from colony PCR.</b> PCR amplicon sizes of colonies with Ana o 3 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
</div>
+
−
 
+
−
 
+
−
<p>These transformants (colonies 1, 3 and 9) had their plasmid extracted by Miniprep and digested by Eco-RI and Eco-RV (expected size of the fragments:  5052 bp and 3211 pb) to assess the assembly (Figure 4).</p>
+
−
 
+
−
 
+
−
<div class="center">
+
−
    <div class="thumb tnone">
+
−
        <div class="thumbinner" style="width:80%;">
+
−
            <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-digestion.png" class="image">
+
−
                <img alt="" src="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-digestion.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                <div class="magnify">
+
−
                    <a href="https://static.igem.wiki/teams/4197/wiki/results/collection-of-allergens/ana-o-3-digestion.png" class="internal" title="Enlarge"></a>
+
−
                </div>
+
−
                <i><b>Figure 4: restriction profile of pET-21 b (+)_Ana o 3 final construction. Enzymes were EcoRI and EcoRV.</b> Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).</i>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
</div>
+
−
 
+
−
 
+
−
 
+
−
<p>The correct restriction maps were observed and these clones were further validated by sequencing. The plasmid was named <b>pET-21 b (+)_OmpA_Ana o 3</b>.</p>
+
−
 
+
−
<p>The plasmid was finally used to transform <i>E. coli</i> Tuner cells to express the OmpA_Ana o 3 construction at the cell membrane.</p>
+
−
 
+
−
 
+
 
      
 
      
−
<h2>Validation</h2>
 
−
 
−
<p>The plasmid was eventually used to transform <i>E. coli</i> Tuner cells in order to express the OmpA_Ana o 3 construction at the cell membrane. The expression and display controls should have been conducted using anti-Ana o 3 antibodies to check wether the allergen displayed on the bacteria were able to link to their specific IgE. However, due to the high price of these  IgE, the experiment was not performed. </p>
 
−
 
−
 
 
<h2>References</h2>
 
<h2>References</h2>
−
 
−
<p>More information about the project for which the part was created:<a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </p>
 
−
 
−
<p>Other parts to display allergens:<br>
 
−
    - <a href="https://parts.igem.org/Part:BBa_K4197008"> OmpA_Ara h 2</a> <br>
 
−
    - <a href="https://parts.igem.org/Part:BBa_K4197009"> OmpA_Gal d 2</a> <br>
 
−
    - <a href="https://parts.igem.org/Part:BBa_K4197006"> OmpA_Der p 1</a> <br>
 
−
</p>
 
−
 
 
<ol>
 
<ol>
 
     <i>
 
     <i>
 +
<li> <a href="https://parts.igem.org/Part:BBa_K4197007">K4197007</a> </li>
 +
<li> <a href="https://parts.igem.org/Part:BBa_K4197012">K4197012</a> </li>
 +
<li> <a href="https://2022.igem.wiki/toulouse-insa-ups/index.html"> DAISY (INSA-UPS 2022)</a> </li>
 +
</i>
 +
</ol>
  
  
−
    <li>Van der Valk, J. P. M., J. Dubois, A. E., Gerth van Wijk, R., Wichers, H. J., de Jong, N. W. (2014). Systematic review on cashew nut allergy. Allergy. 69(6), 692–698. doi:10.1111/all.12401 </li>
 
−
 
−
    <li>Sato, S., Movérare, R., Ohya, Y., Ito, K., Nagao, M., Borres, M. P., & Ebisawa, M. (2019). Ana o 3–specific IgE is a predictive marker for cashew oral food challenge failure. The Journal of Allergy and Clinical Immunology : In Practice, 7(8), 2909–2911.e4. https://doi.org/10.1016/j.jaip.2019.04.049</li>
 
−
 
−
    <li>Robotham, J. M., Wang, F., Seamon, V., Teuber, S. S., Sathe, S. K., Sampson, H. A., Beyer, K., Seavy, M., & Roux, K. H. (2005). Ana o 3, an important cashew nut (Anacardium occidentale L.) allergen of the 2S albumin family. Journal of Allergy and Clinical Immunology, 115(6), 1284–1290.</li>
 
−
 
−
    <li>Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009</li>
 
−
 
−
<li>Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001</li>
 
−
</i>
 
−
</ol>
 
 
</html>
 
</html>
  
Line 139: Line 78:
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
−
<partinfo>BBa_K4197007 SequenceAndFeatures</partinfo>
+
<partinfo>BBa_K4197003 SequenceAndFeatures</partinfo>
  
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
−
<partinfo>BBa_K4197007 parameters</partinfo>
+
<partinfo>BBa_K4197003 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Revision as of 17:29, 8 October 2022


Ana o 3 expression at the surface of E. coli cells sortable by FACS using mRFP1

Brick expressing Ana o 3 at the surface of E. coli cell sortable by FACS

Introduction

The part expressing the gene of cashew nut Ana o 3 (K4197007) has been completed with the ihfb800-RFP construction (K41970012) to express red fluorescence. This red fluorescence allows sorting of bacteria by FACS.

Construction

The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R (cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ana o 3 (K4197007) by In-Fusion.

The resulting products were transformed into Stellar cells and transformants were selected. Colonies were screened by PCR using screening_insert_R (ccgaaacaagcgctcatgagc) and screening_insert_F (ggttatgctagttattgctcagc) primers. The expected sizes of amplicons was 2944 bp with RFP and 1453 bp without RFP.

Figure 1: Verification of the insertion of RFP fragment in Ana o 3 with gel. The PCR screening was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colony 8 has shown the right size.

Validation

Successful colonies were further tested by digestion with NotI which cut both in the plasmid and in the mRFP1 gene (Figure 2). Correct sizes were expected to be 1178 and 6791 bp for Ara h 2.

Figure 2: Digestion by NotI of Ana o 3 with mRFP1 insertion. The digestion product was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). colonies 21 and 23 present the correct size for Ana o 3.

This construction has not shown red fluorescence on the microscope. After sequencing, a mutation has been revealed on the mRFP sequence which does not allow us to continue further with this construction.

References

  1. K4197007
  2. K4197012
  3. DAISY (INSA-UPS 2022)

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal NheI site found at 1703
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal NotI site found at 1519
    Illegal NotI site found at 2697
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal BglII site found at 1592
    Illegal BamHI site found at 1735
    Illegal XhoI site found at 2706
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
    Illegal AgeI site found at 1360
    Illegal AgeI site found at 1472
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 2368