Difference between revisions of "Part:BBa K4197003"

Revision as of 17:15, 8 October 2022

Ana o 3 expression at the surface of E. coli cells sortable by FACS using mRFP1

Brick expressing Ana o 3 at the surface of E. coli cell sortable by FACS

Introduction

The part expressing the gene of cashew nut Ana o 3 (K4197007) has been completed with the ihfb800-RFP construction (K4197012) to express red fluorescence. This red fluorescence allows sorting of bacteria by FACS.

Construction

The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R (cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ana o 3 (K4197007) by In-Fusion.

The resulting products were transformed into Stellar cells and transformants were selected. Colonies were screened by PCR using screening_insert_R (ccgaaacaagcgctcatgagc) and screening_insert_F (ggttatgctagttattgctcagc) primers. The expected sizes of amplicons was 2944 bp with RFP and 1453 bp without RFP.

Figure 1: Verification of the insertion of RFP fragment in Ana o 3 with gel. The PCR screening was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colony 8 has shown the right size.

Xxxxxxxxx

Xxxxxxxxxxxxx

Figure 2: Xxxxxxxxxxxxx Xxxxxxxxxxxxx.

titre 2

Titre 3

Xxxxxxxxxx

• Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
• Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG

Xxxxxxxxxx

• CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
• Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG

titre 3

Titre 4

Xxxxxx

Titre 4

xxxxxxx

Titre 2

Xxxxxx

References

1. Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
2. Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
3. Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.

Sequence and Features