Difference between revisions of "Part:BBa K4221005"

 
Line 2: Line 2:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K4221005 short</partinfo>
 
<partinfo>BBa_K4221005 short</partinfo>
 
 
 
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
  
 
<!-- -->
 
<!-- -->
Line 18: Line 12:
 
<partinfo>BBa_K4221005 parameters</partinfo>
 
<partinfo>BBa_K4221005 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===Usage===
 +
Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.
 +
Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA.
 +
Using mHoneydew[2] as target proteincan visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.
 +
 +
===Biology===
 +
Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]
 +
 +
===Design Consideration===
 +
The construct was cloned into a PET28a plasmid and transformed into mHoneydew-PET28a [2]
 +
The construction includes:
 +
mHoneydew is fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT)
 +
and TEVlinker(GAAAACCTGTACTTCCAGGGTTCTGGT)
 +
 +
===Detection of fusion protein function===
 +
After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant
 +
 +
Figure 1. Water contact angle.
 +
 +
===Aqueous two-phase separation (ATPS) Testing===
 +
we used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.
 +
 +
Figure 2. ATPS testing.
 +
 +
 +
===Reference===
 +
[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)
 +
[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.
 +
[3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.
 +
 +
 +
<!-- Add more about the biology of this part here
 +
===Usage and Biology===

Revision as of 14:38, 8 October 2022


mHoneydew

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 104
    Illegal AgeI site found at 555
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage

Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants. Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using mHoneydew[2] as target proteincan visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.

Biology

Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]

Design Consideration

The construct was cloned into a PET28a plasmid and transformed into mHoneydew-PET28a [2] The construction includes: mHoneydew is fused with BslA with a GS linker(GGTGGTGGCGGCAGCGGCGGAGGCGGTAGT) and TEVlinker(GAAAACCTGTACTTCCAGGGTTCTGGT)

Detection of fusion protein function

After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant

Figure 1. Water contact angle.

Aqueous two-phase separation (ATPS) Testing

we used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.

Figure 2. ATPS testing.


Reference

[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30) [2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73. [3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.