Difference between revisions of "Part:BBa K4197007"

Revision as of 07:17, 8 October 2022 (view source) Brice (Talk | contribs) ← Older edit		Revision as of 08:02, 8 October 2022 (view source) Brice (Talk | contribs) Newer edit →
Line 113:		Line 113:
	<p>Other parts to display allergens:<br>		<p>Other parts to display allergens:<br>
	- <a href="https://parts.igem.org/Part:BBa_K4197008"> OmpA_Ara h 2</a> <br>		- <a href="https://parts.igem.org/Part:BBa_K4197008"> OmpA_Ara h 2</a> <br>
−	- <a href="https://parts.igem.org/Part:BBa_K4197007"> OmpA_Ana o 3</a> <br>	+	- <a href="https://parts.igem.org/Part:BBa_K4197009"> OmpA_Gal d 2</a> <br>
−	- <a href="https://parts.igem.org/Part:BBa_K4197006"> OmpA_Fel d 4</a> <br>	+	- <a href="https://parts.igem.org/Part:BBa_K4197006"> OmpA_Der p 1</a> <br>
	</p>		</p>

---

Revision as of 08:02, 8 October 2022

OmpA_Ana o 3 fusion

Gene fusion to express the cashew allergen Ana o 3 on the surface of E. coli.

Introduction

This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: AAL91665.1). The cashew allergy prevalence is higher than 0,08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy (Sato and al. 2019). Ana o 3 have already been expressed in E. coli and was able to bind the IgE of patient with cashew's allergie (Robotham and al. 2005). Ana o 3 was merged to the membrane protein OmpA of E. coli (BBa_K1694002), to display Ana o 3 on the surface of E. coli. This lipoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).

Construction

Ana o 3 gene ordered on IDT was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen F and IF4 Ana o 3. Expected size of the amplicon was 479 bp.

Amplification product sizes were checked on Ethidium bromide stained agarose gel (Figure 1).

The products matched expected sizes and amplicons were further purified from the gel.

To merge Ana o 3 to OmpA, the gene was inserted in a pET-21 b (+) plasmid containing OmpA merged to Gal d 2, another allergen. The plasmid was linearized, excluding the Gal d 2 fragment by PCR. The primers used were IF1_allergen (gctctgaaaatacaggttttcactg)and IF2_plasmid (ttaaagcttgcggccgcactcg). Expected size of the amplicon was 5924 bp.

Amplification product sizes were checked on thidium bromide stained agarose gel (Figure 2).

In-Fusion assemby reaction was performed to insert Ana o 3 in the plasmid and transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone (primers used: screening_inserts-F:ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc). 4 positive transformants were detected (Figure 3).

These transformants (colonies 1, 3 and 9) had their plasmid extracted by Miniprep and digested by Eco-RI and Eco-RV (expected size of the fragments: 5052 bp and 3211 pb) to assess the assembly (Figure 4).

The correct restriction maps were observed and these clones were further validated by sequencing. The plasmid was named pET-21 b (+)_OmpA_Ana o 3.

The plasmid was finally used to transform E. coli Tuner cells to express the OmpA_Ana o 3 construction at the cell membrane.

Validation

The plasmid was eventually used to transform E. coli Tuner cells in order to express the OmpA_Ana o 3 construction at the cell membrane. The expression and display controls should have been conducted using anti-Ana o 3 antibodies to check wether the allergen displayed on the bacteria were able to link to their specific IgE. However, due to the high price of these IgE, the experiment was not performed.

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Gal d 2
- OmpA_Der p 1

1. Van der Valk, J. P. M., J. Dubois, A. E., Gerth van Wijk, R., Wichers, H. J., de Jong, N. W. (2014). Systematic review on cashew nut allergy. Allergy. 69(6), 692–698. doi:10.1111/all.12401
2. Sato, S., Movérare, R., Ohya, Y., Ito, K., Nagao, M., Borres, M. P., & Ebisawa, M. (2019). Ana o 3–specific IgE is a predictive marker for cashew oral food challenge failure. The Journal of Allergy and Clinical Immunology : In Practice, 7(8), 2909–2911.e4. https://doi.org/10.1016/j.jaip.2019.04.049
3. Robotham, J. M., Wang, F., Seamon, V., Teuber, S. S., Sathe, S. K., Sampson, H. A., Beyer, K., Seavy, M., & Roux, K. H. (2005). Ana o 3, an important cashew nut (Anacardium occidentale L.) allergen of the 2S albumin family. Journal of Allergy and Clinical Immunology, 115(6), 1284–1290.
4. Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
5. Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001

Sequence and Features