Difference between revisions of "Part:BBa K4197008"
Line 3: Line 3:
 
<partinfo>BBa_K4197008 short</partinfo>
 
<partinfo>BBa_K4197008 short</partinfo>
  
−
Gene fusion to express the egg allergen Ara h 2 on the surface of <i>E. coli </i>.  
+
Gene fusion to express the peanut allergen Ara h 2 on the surface of <i>E. coli </i>.  
  
 
<html>
 
<html>
Line 74: Line 74:
 
     <li>Lieberman, J., Sublett, J., Ali, Y., Haselkorn, T., Damle, V., Chidambaram, A., Rosen, K., & Mahr, T. (2018). INCREASED INCIDENCE AND PREVALENCE OF PEANUT ALLERGY IN CHILDREN AND ADOLESCENTS IN THE UNITED STATES. Annals of Allergy, Asthma & ; Immunology, 121(5), S13. https://doi.org/10.1016/j.anai.2018.09.039</li>
 
     <li>Lieberman, J., Sublett, J., Ali, Y., Haselkorn, T., Damle, V., Chidambaram, A., Rosen, K., & Mahr, T. (2018). INCREASED INCIDENCE AND PREVALENCE OF PEANUT ALLERGY IN CHILDREN AND ADOLESCENTS IN THE UNITED STATES. Annals of Allergy, Asthma & ; Immunology, 121(5), S13. https://doi.org/10.1016/j.anai.2018.09.039</li>
 
     <li>Lehmann, K., Hoffmann, S., Neudecker, P., Suhr, M., Becker, W.-M., & Rösch, P. (2003). High-yield expression in Escherichia coli, purification, and characterization of properly folded major peanut allergen Ara h 2. Protein Expression and Purification, 31(2), 250–259. https://doi.org/10.1016/s1046-5928(03)00190-6</li>
 
     <li>Lehmann, K., Hoffmann, S., Neudecker, P., Suhr, M., Becker, W.-M., & Rösch, P. (2003). High-yield expression in Escherichia coli, purification, and characterization of properly folded major peanut allergen Ara h 2. Protein Expression and Purification, 31(2), 250–259. https://doi.org/10.1016/s1046-5928(03)00190-6</li>
−
     <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li>
+
     <li>Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009</li>
 +
 
 +
<li>Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001</li>
 
</i>
 
</i>
 
</ol>
 
</ol>

Revision as of 14:26, 6 October 2022


OmpA_Ara h 2 fusion

Gene fusion to express the peanut allergen Ara h 2 on the surface of E. coli .

Introduction

This part is composed of the gene coding for the allergen of peanu Ara h 2 (NCBI: AY158467.1). The peanut allergy prevalence is superior to 5% (lieberman and al. 2018) in developped countries and Ara h 2, among the 17 other peanut allergens, triggers 90% of the patients with peanut allergy (lehmann and al. 2003). Ara h 2 have already been expressed in E. coli and was able to bind the IgE of patient with peanut's allergie (lehmann and al. 2003). Ara h 2 was merged to the membrane protein OmpA of E. coli (BBa_K1694002), to display Ara h on the surface of E. coli . This lippoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).

Construction

Xxxxx xxxxx xxxxx xxxxxx xxxx

Figure 1: Xxxxxx Xxxxxxxxxxxxxxxxxxxxxxxxxxx.

Xxxxxxxxx

Xxxxxxxxxxxxx

Figure 2: Xxxxxxxxxxxxx Xxxxxxxxxxxxx.

titre 2

Titre 3

Xxxxxxxxxx

  • Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
  • Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG

Xxxxxxxxxx

  • CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
  • Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG

titre 3

Titre 4

Xxxxxx

Titre 4

xxxxxxx

Titre 2

Xxxxxx

References

  1. Lieberman, J., Sublett, J., Ali, Y., Haselkorn, T., Damle, V., Chidambaram, A., Rosen, K., & Mahr, T. (2018). INCREASED INCIDENCE AND PREVALENCE OF PEANUT ALLERGY IN CHILDREN AND ADOLESCENTS IN THE UNITED STATES. Annals of Allergy, Asthma & ; Immunology, 121(5), S13. https://doi.org/10.1016/j.anai.2018.09.039
  2. Lehmann, K., Hoffmann, S., Neudecker, P., Suhr, M., Becker, W.-M., & Rösch, P. (2003). High-yield expression in Escherichia coli, purification, and characterization of properly folded major peanut allergen Ara h 2. Protein Expression and Purification, 31(2), 250–259. https://doi.org/10.1016/s1046-5928(03)00190-6
  3. Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
  4. Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001
    5.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 130
    Illegal NheI site found at 92
    Illegal NotI site found at 1188
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 130
    Illegal BamHI site found at 124
    Illegal BamHI site found at 813
    Illegal BamHI site found at 834
    Illegal XhoI site found at 1197
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 713