Difference between revisions of "Part:BBa K4197018"

The Gal d 2-OmpA construction was then inserted into pET-21 b (+) by In-Fusion. The resulting products were transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 20 transformants were screened by colony PCR with primer pairs flanking the insertion zone (FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc, expected size of the amplicon : 2092 bp). 2 positive transformants were detected (Figure 3).

Figure 2: identifying fragments that bear pET21 b (+)_Ompa_Gal d 2 by colony PCR. Expected size of the amplicon was 2092 bp. The positive clones were colonies 17 and 24. PCR amplicon sizes of colonies with Gal d 2 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

These transformants had their plasmid extracted by Miniprep and digested by EcoRV to assess the assembly (expected fragments at 4332 bp and 2785 bp, see Figure 4).

Figure 3: restriction profile of pET-21 b (+)_OmpA_Gal d 2 final construction. Enzyme used was EcoRV. Expected sizes of the amplicons were 4332 bp and 2785 bp. Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

The correct restriction maps were obtained and the insert sequence was further validated by sequencing. The plasmid was named pET-21 b (+)_OmpA_Gal d 2. The plasmids were eventually used to transform E. coli Tuner cells in order to express the OmpA_Gal d 2 construction at the cell membrane. But no proof was obtain of the expression.

References

1. Dhanapala, P., Doran, T., Tang, M. L. K., & Suphioglu, C. (2015). Production and immunological analysis of IgE reactive recombinant egg white allergens expressed in Escherichia coli. Molecular Immunology, 65(1), 104–112. https://doi.org/10.1016/j.molimm.2015.01.006
2. Palosuo, K., Kukkonen, A. K., Pelkonen, A. S., & Mäkelä, M. J. (2018). Gal d 1-specific IgE predicts allergy to heated egg in Finnish children. Pediatric Allergy and Immunology, 29(6), 637–643. https://doi.org/10.1111/pai.12954
3. Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
4. Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001

Sequence and Features