Difference between revisions of "Part:BBa K2926001"

(Contribution (iGEM22_Thessaloniki_Meta))
(Contribution (iGEM22_Thessaloniki_Meta))
Line 255: Line 255:
 
<li>Golden Gate assembly of the PCR amplified LacI-promoter-RBS and Cas13a Lbu parts (BBa_K2926001) along with the ‘linearized’ pSB1C3 backbone part for the efficient construction of the LbuCas13a coding sequence under the transcriptional control of the Lac Repressor.</li>
 
<li>Golden Gate assembly of the PCR amplified LacI-promoter-RBS and Cas13a Lbu parts (BBa_K2926001) along with the ‘linearized’ pSB1C3 backbone part for the efficient construction of the LbuCas13a coding sequence under the transcriptional control of the Lac Repressor.</li>
 
</li>
 
</li>
 +
  
 
The final plasmid after the Golden Gate assembly contains the same DNA elements/features as the cloned final SUMO-LbuCas13a coding device under T7 promoter (BBa_K4170016), replacing the CDS of the codon-optimized Cas13a with the CDS of Cas13a Lbu (BBa_K2926001). Furthermore, the CDS of the molecular chaperone SUMO sequence has also been removed. In addition, utilizing this cloning strategy we incorporated the 6xHis affinity tag at the N-terminus of the Cas13a Lbu (BBa_K2926001) to facilitate the efficient purification of the protein utilizing a Ni-NTA affinity purification methodology.
 
The final plasmid after the Golden Gate assembly contains the same DNA elements/features as the cloned final SUMO-LbuCas13a coding device under T7 promoter (BBa_K4170016), replacing the CDS of the codon-optimized Cas13a with the CDS of Cas13a Lbu (BBa_K2926001). Furthermore, the CDS of the molecular chaperone SUMO sequence has also been removed. In addition, utilizing this cloning strategy we incorporated the 6xHis affinity tag at the N-terminus of the Cas13a Lbu (BBa_K2926001) to facilitate the efficient purification of the protein utilizing a Ni-NTA affinity purification methodology.
 +
 +
 +
<u>Expression of recombinant LbuCas13a proteins.</u>
 +
 +
<ul>
 +
<li>The procedure of the protein expression initiates with the preparation of the bacterial pre-culture (15ml) incubated overnight at 37 °C. The following day the pre-culture was diluted in 1L of nutrient media, followed by a further incubation at 37°C of the diluted pre-culture until Optical Density (OD600) reached 0.7 – 0.8 (continuous measurements at the photometer at specific time points).</li>
 +
 +
<li>To induce LbuCas13a protein expression we added IPTG to the 1L bacterial culture to achieve a final concentration of 1mM. The bacterial culture was then incubated for 6 hours at 37°C. After overnight incubation, the bacterial culture was centrifuged at 10.000 g for 20 min at 4 °C and the supernatant was discarded. The bacterial pellets were resuspended in binding buffer (3oomM NaCl, 50mM NaH2PO4, 10mM imidazole, pH 8) followed by successive freeze-thaw cycles. After the freeze-thaw steps, Lysozyme (100mg/ml) and Triton x-100 were added and ultrasonication was performed to lyse the bacterial membrane. After ultrasonication, DNase (1mg/ml), MgCl2 (8mM) and Protease Inhibitor (PI) were added and the samples were incubated in a cold room for 2 hours on a rotator machine.</li>
 +
 +
<li>To obtain the soluble fraction of the protein, refrigerated centrifugation was carried out and the supernatant was then filtered by using 0.22 μm filter units.  The remaining pellet constitutes the Inclusion Bodies (IBs), which also contains the insoluble form of the protein of interest. To isolate the SUMO-LbuCas13a protein from the IBs, the bacterial pellet is subjected to successive washing steps using 3 different buffers (A, B, C) followed by ultracentrifugation at 30.000g for 20 min at 4 C. The process is completed by resuspending the protein in L-Arginine solution which promotes the proper folding of the protein restoring its functional quaternary structure.</li>
 +
</ul>
 +
 +
 +
'''SDS-PAGE gel electrophoresis and Western blotting of Cas13a Lbu (BBa_K2926001) '''
 +
 +
Equal volumes of protein samples corresponding to the filtered soluble and resuspended insoluble (IBs) solution respectively, were loaded into each well of the SDS-PAGE gel for separation based on molecular weight. After gel electrophoresis completion, suitable images of the gels were obtained. After the separation of the protein mixture through the SDS-PAGE gel electrophoresis, it was transferred to the PVDF membrane for western blotting. After the initial blocking step, the addition of the anti-His primary and the anti-mouse alkaline Phosphatase-Labeled secondary antibody, the protein bands were detected using the alkaline phosphatase detection method. 
 +
 +
 +
photo
 +
 +
'''Analyzing the results from the SDS-PAGE gel electrophoresis and the Western Blotting (Figure 3) we can conclude that the Cas13a Lbu (BBa_K2926001) protein is detected only in the insoluble fraction which corresponds to the inclusion bodies of the bacteria. The protein band which corresponds to the LbuCas13a protein is detected at the molecular weight of 130kDa. However, no LbuCas13a protein band is detected at the soluble cytoplasmic fraction. The process of obtaining bioactive functional protein from inclusion bodies is usually labor intensive and the yields of the recovered recombinant protein are often low.'''
 +
 +
 +
'''SDS-PAGE gel electrophoresis and Western blotting of “improved” SUMO-LbuCas13a protein (BBa_K4170016)'''
 +
 +
Equal volumes of protein samples corresponding to the filtered soluble and resuspended insoluble (IBs) solution respectively, were loaded into each well of the SDS-PAGE gel for separation based on molecular weight. After gel electrophoresis completion, suitable images of the gels were obtained. After the separation of the protein mixture through the SDS–PAGE gel electrophoresis, it was transferred to the PVDF membrane for western blotting. After the initial blocking step, the addition of the anti-His primary and the anti-mouse alkaline Phosphatase-Labeled secondary antibody, the protein bands were detected using the alkaline phosphatase detection method.
 +
 +
photo
 +
 +
'''Analyzing the results from the SDS-PAGE gel electrophoresis and the Western Blotting (Figure 4) we can conclude that the SUMO-LbuCas13a is detected in both the soluble and insoluble fraction (Inclusion Bodies). The protein band which corresponds to the SUMO-LbuCas13a fusion protein is detected at the molecular weight of 155kDa. Therefore, we can assume that the addition of the SUMO solubility tag enhanced the soluble fraction of the LbuCas13a protein. The purification of soluble proteins is less expensive and time consuming compared to the process needed for protein purification and recovery from inclusion bodies. Utilizing the chaperone-mediated LbuCas13a protein recovery from soluble fraction ensures the integrity of the refolded proteins. The resolubilization procedures required to recover the protein from inclusion bodies can disturb the integrity of the protein. In addition, if we compare the Figures 4 and 5 which correspond to the Cas13a Lbu (BBa_K2926001) and SUMO-LbuCas13a (BBa_K4170016) respectively, we can understand that the codon optimization procedure enhanced the total protein yield in both the soluble and the insoluble fraction of the LbuCas13a protein. Further information about the downstream experiments regarding the SUMO-LbuCas13a purification with His SpinTrap purification columns and the enzymatic removal of the SUMO protein can be found on the results and on the experiments pages. '''
 +
  
 
'''References''':
 
'''References''':

Revision as of 12:11, 4 October 2022


Cas13a Lbu

This part codes for Cas13a derived from Leptotrichia buccalis. The natural EcoRI and PstI restriction sites were removed via mutagenesis PCR.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 344
    Illegal BglII site found at 1280
    Illegal BglII site found at 1544
    Illegal BglII site found at 2048
    Illegal BglII site found at 2534
    Illegal BglII site found at 2642
    Illegal BglII site found at 2972
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 2653



SDS-PAGEof purified Cas13a proteins Lsh, Lbu and Lwa. Marked bands indicate the further used proteins bands for analysis by MALDI-ToF MS/MS.
To further analyze the expressed Cas proteins and compare them to the expected protein sequence, the marked bands were excised from the SDS-PAGE, washed, digested with trypsine and analyzed in a MALDI-ToF MS/MS. The generated mass spectra and mass lists were evaluated using the software BioTools.
Mass spectrum of the proteins Cas13a Lbu (1) and Cas13a Lsh (2) after tryptic digestcompared to the theoretical mass spectrum. Excised bands from the SDS-PAGE of Cas13a Lbu and Cas13a Lsh were washed, digested over night with trypsine and co-cristallyzed with a α-Cyano-4-hydoxycinnamic acid-matrix on a MALDI target. The mass spectrum was recorded in a MALDI-ToF MS from Bruker Daltronics and data was evaluated using the software BioTools.
Using this technique, we successfully confirmed that Cas13a Lbu and Lsh were expressed and purified from the expression strain. For the Cas13a activity in-vitro assay we designed single guide RNAs (gRNAs) targeting a RFP gene. The following gRNA was ordered via RNA synthesis from IDT.
CAAAGCTTACGTTAAACACCCGATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC
The target RNA was isolated from an overnight culture of E. coli DH5α with pSB1K3_RFP, purified with the RNA isolation kit from ZYMO Research. The activity of the Cas protein was determined using our Cas13a activity assay protocol based on the RNAse Alert-Kit by Thermo Fischer and evaluated via fluorescent measurement with a plate reader. We tested the Cas with the gRNA and the target RNA as well as the Cas and gRNA without the target RNA, to account for any offsite effects. Due to the low yield we did not conduct the experiment with Lwa. Lbu has been used in a concentration of 2.3 µM, while the concentration of Lsh was 0.08 µM.
In vitro activity of Cas13a Lsh and Cas13a Lbu using the Cas13a activity array based on the RNAse Alert kit (Thermo Fischer). Development of the fluorescence intensity based on the activity of Cas13a Lbu and Lsh over a period of 12 h. For each Cas variant the activity was measured with all essential parts for the activation of Cas13a including the Cas13a protein, gRNA and the target RNA (for Lsh shown in dark purple and Lbu in dark blue) To show any possible offsite events, the activity was also measured without providing of the target RNA (for Lsh pictured in red and Lbu in light blue).
We validated the functionality of both Cas13a Lsh and Lbu. Lsh as well as Lbu show an activity. However, Lsh showed a higher activity than Lbu. Furthermore, the negative controls without any target RNA also showed a slight increase of fluorescence intensity. Thereby, the Lbu negative control showed a higher activity than the Lsh control. The activity without the target RNA present can indicate offsite activity but it can also be influenced by airborne RNAse. As both of the received parts are functional, we performed growth experiments with the complete CeDIS system in pRS304 in S. cerevisea INVSc1. Additionally, we also transformed S. cerevisiae with pRS304 Cas13a Lwa to perform growth experiments and test its functionality.

Proof of concept: Cas13a as a Cell Death inducing system (CeDIS)

In order to test the functionality of our CeDIS system, we conducted growth experiments with INVSc1, S. cerevisiae Yeast Strain containing the system. The strain carries a tryptophan autotrophy. All experiments for the proof of concept were performed with the CeDIS encoded on pRS304. The yeast was grown in liquid SD media without tryptophan, to ensure the selective growth of transformed yeast.
Our initial tests were conducted with yeast, where the cultures had been grown on YPD media. Once an OD of 0.8 had been reached the cells were washed and a medium change was performed. Afterwards the cells were induced by the usage of an YP medium containing galactose as a carbon source. In this initial test Cas13a Lwa and Cas13a Lbu in pRS304 were tested.
Growth experiment of S.cerevisea INVSc1 transformed with pRS304_Lbu to assess the functionality of the CeDIS. All yeasts were cultivated were cultivated on glucose containing SD medium in 250 mL shaker flasks at a temperature of 30°C and 180 rpm. The results were normalized to the starting value of each culture to allow for a better comparison between them. As a control the wild type S. cerevisea was grown on glucose (red) containing media, and equal treated to the galactose induced cells (dark purple). S. cerevisea transformed with pRS304_Lbu was grown on the inhibitor glucose (dark blue), to show the effects in an undinduced state. Furthermore a galactose induced culture containing pRS304_Lbu (light blue) was measured.
Growth experiment of S.cerevisea INVSc1 transformed with pRS304_Lwa to assess the functionality of the CeDIS. All yeasts were cultivated were cultivated on glucose containing SD medium in 250 mL shaker flasks at a temperature of 30°C and 180 rpm. The results were normalized to the starting value of each culture to allow for a better comparison between them. As a control the wild type S. cerevisea was grown on glucose (red) containing media, and equal treated to the galactose induced cells (dark purple). S. cerevisea transformed with pRS304_Lbu was grown on the inhibitor glucose (dark blue), to show the effects in an undinduced state. Furthermore a galactose induced culture containing pRS304_Lwa (light blue) was measured.
During the growth experiments there was no significant difference between the growth of S. cerevisea with and without the Cas13a protein. For both the growth on galactose however is significantly decreased than it is on glucose. After the growth experiment the presence of both variants of Cas13a was verified by colony PCR.
In order to figure out why there was no difference in growth with and without the presence of the Cas13a protein, we tested the Lab application in both glucose containing medium and galactose containing medium, as well as simulated a change of medium similar as performed in the growth experiments. As the Lab application plasmid contains a fluorescent marker, the activation of the GALL promoter was easily detectable via a plate reader.
S. cerevisiae transformed with the Lab application was cultivated in SD media containing raffinose (Raff), glucose (Glu) or galactose (Gal) at 30 °C and 180 rpm. Samples marked with ind. were induced with 2 % galactose at an OD of 0.4. The measurement took place 2 h after induction. Three samples were taken of each culture and the fluorescence intensity was measured using the TECAN plate reader infinite M200 (λEx=449 nm, λEm=525 nm, gain calculated from 2.5 µM fluorescein). The results were normalized to the max. fluorescence intensity of cells continuously grown on raffinose.
The results indicate, that there is a slight fluorescence in the presence of glucose (in Fig. 14 shown in red). Especially interesting is the sample with the medium exchange from glucose containing medium to galactose containing medium, as there is no significant increase in fluorescence intensity detectable (Fig. 14 shown in dark purple). The promoter activity is almost completely inhibited in the presence of glucose and does not show any activation 2 h after induction. In galactose however, a clear fluorescence intensity, proving the functionality and its proper induction of the promoter in yeast (Fig. 14 shown in light blue). This is due to the fact, that the GALL promoter is strongly inhibited by glucose and the activation by galactose proceeds slow (Hovlanda et al., 1989). To avoid the slow activation, we tested the use of raffinose in the media for the growth of the cultures and added galactose when higher cell densities were reached to induce the GALL promoter. In comparison to the induction after growth in glucose medium, with the growth on raffinose there is a strong increase of fluorescence intensity when induced afterwards (Fig. 14 shown in dark blue). It is shown, that the cultivate in raffinose instead of glucose is beneficial for the fast and efficient induction of the promoter
According to these results, the cultures were grown in an SD medium with raffinose as sole carbon source and without tryptophan. Even though the inhibition of the GALL promoter with raffinose is weaker than with glucose, the activation by galactose is much faster, which is desirable for our purpose. Furthermore, based on the advice of experts the activation will occur at an OD600 of 0.4.
Growth experiment of S. cerevisea INVSc1 transformed with pRS304_Lbu to assess the functionality of the CeDIS. All yeasts were cultivated on 2% raffinose containing SD medium in 250mL shaker flasks at a temperature of 3°C and 180 rpm. As a control, the wild type S. cerevisea was cultivated in raffinose (red) containing mediumand treated equal to the 2% galactose induced cells (dark purple). S. cerevisea transformed with pRS304_Lbu was grown on selective raffinose containing SD medium (dark blue). Furthermore a galactose induced cells containing pRS304_Lbu (light blue) were cultivated.
Growth experiment of S.cerevisea INVSc1 transformed with pRS304_Lwa to assess the functionality of the CeDIS All yeasts were cultivated on 2% raffinose containing SD medium in 250mL shaker flasks at a temperature of 30 degress celcius at 180 rpm. As a control the wild type S.cerevisea was grown on raffinose(red), as well as treated as if it would be induced with 2% galactose (dark purple). S. cerevisea transformed with pRS304_Lwa was grown on selective raffinose SD medium (dark blue). Furthermore an galactose induced culture containing pRS304_Lwa (light blue) was measured
While yeast containing Cas13a Lwa shows a slight decrease in growth, there is no indication, that the CeDIS is fully activated or functional within the cell. It has previously been reported, that Cas13a Lwa does not produce any unspecific cleavage events in eukaryotes (Cox et al., 2017). Therefore, no unspecific cleavage events occur, making Lwa unfeasible for our system (Wolter & Puchta, 2018). This function is useful when it comes to downregulation of a gene, however it is not feasible for the purpose of a complete knockout or cell death induction. However, for other Cas13a variants collateral cleavage has been described (Abudayyeh et al., 2016).
The results of the cultivation with Cas13a Lbu however shows that the cells reach a premature stationary phase. This indicates, that the growth of the yeast is decreased and indicates collateral cleavage events of the Cas13a. Over the duration of 10 hours there is no significant increase in the OD600 of the induced cells carrying the CeDIS. However, the yeast containing the Cas13a show a significant decrease of growth even with the uninduced cells. The control WT S. cerevisiae also shows a difference in growth on raffinose and galactose. The variation of the OD600 for the Cas carrying yeast can be assigned to the variation in carbon source. While these results show that the CeDIS containing Cas13a is active and effective within yeast, it also indicates that there is a background activity when raffinose is used as an inhibitor of the GALL promoter. Even in the uninduced state, Cas is expressed a on a low level , which leads to a decrease in growth, even if it is less effective than in the induced state.
This can potentially be explained by the structure of raffinose. Raffinose is a trisaccharaide consisting of galactose, glucose and fructose.
Structure of raffinose containing in this order galactose, glucose and fructose
While the galactose, which activates the promoter, is readily accessible due to its position, the inhibitor glucose however is bound by the other two saccharides, galactose and fructose, and might not be fully available for the inhibition of the promoter. This could explain why the difference between induced and uninduced growth is smaller than expected. Furthermore, after transformation the yeast cells have to produce the amino acid tryptophan on their own, as they are grown on a selective medium. This also increases the stress on the cells and could also contribute to the decrease in growth.
According to the previously obtained results we altered our experimental set up. The yeasts are further cultivated on an SD-medium containing raffinose as a sole carbon source, however 4 % (w/v) of galactose added to induce the cells, while the uninduced cultures received 4 % (w/v) of glucose. Thereby we inhibit the GALL promoter in our control samples which will lead to the cells recovering from the previous damage they received by the production of the CeDIS.
The tests have been conducted for both Cas13a Lwa and Cas13a Lsh.
Growth experiment of S. cerevisea INVSc1 transformed with pRS304_Lsh to prove the functionality of the CeDIS.
All yeasts were cultivated on 2% raffinose containing SD medium in 250mL shaker flasks at 30°C and180 rpm. As a control the wild type S. cerevisea was grown on raffinose and at the time of induction was inhibited with 4% glucose (red), as well as treated equal to the cells induced with 2 % galactose (dark purple). S. cerevisea transformed with pRS304_Lsh was cultivated in SD medium with raffinose as sole carbon source and at of the time of induction inhibited by addition of 4% glucose (dark blue). Furthermore, a galactose induced culture containing pRS304_Lsh (light blue) was cultivated.
Growth experiment of S.cerevisea INVSc1 transformed with pRS304_Lwa to assess the functionality of the CeDIS
All yeasts were cultivated on 2% raffinose containing SD medium in 250mL shaker flasks at a temperature of 30 degress celcius at 180 rpm. As a control the wild type S.cerevisea was grown on raffinose and at the point of induction inhibited with 4% glucose(red), as well as treated as if it would be induced with 2% galactose (dark purple). S. cerevisea transformed with pRS304_Lwa was grown on selective SD medium with raffinose as a carbon source, and at point of induction inhibited by addition of 4% glucose (dark blue). Furthermore a galactose induced culture containing pRS304_Lwa (light blue) was measured .
In accordance with the previous experiments,previous experiments, Cas13a Lwa effects a significant reduction in growth, however it does not lead to a premature stationary phase. This confirms the downregulation of RNA rather than an induction of cell death. Even though, this is useful for many applications but not suitable for the design of our CeDIS. Cas13a Lsh however clearly indicates an induction of cell death, when induced with galactose, as a stationary phase with only slight fluctuations after a cultivation time of 10 h. Furthermore, the relative OD600 reached is three times smaller than the OD600 reached by the control group of WT Yeast grown on raffinose with the addition of galactose. The inhibited culture containing Lsh shows a strong reduction of growth rate compared to the control WT cultivation and reaches only 50% of the maximum OD of the control but opposed to the induced sample has a constant growth. This indicates, that the culture was already struggling before the inhibition due to the background activity, but an active inhibition does relieve some of the stress on the culture. It reaches its plateau after 22h which corresponds well with the control grown on both galactose and glucose.
In summary, we showed that CeDIS has the potential to be used as an efficient method to induce the death of a targeted cell. Both Cas13a Lbu and Cas13a Lsh show a high potential to be used in this context and are viable options for the implementation of our CeDIS. However, Lsh showed a higher activity and less off target activation during the in vitro analysis and could be more suitable for the CeDIS.

Contribution (Waterloo iGEM 2021)

Summary: CRISPR-Cas systems, such as CRIPSR-Cas13a from Leptotrichia buccalis, have a multitude of applications. iGEM Bielefeld-CeBiTec 2019's CeDIS, described above, is an excellent example of one of these applications: RNA targeting and subsequent nonspecific cleavage of RNA to induce cell death. In the discussion below, Waterloo iGEM 2021 hopes to add background information on the usage of Cas13a. As well, we hope to highlight another application of Cas13a, which has become the focus of recent SARS-CoV-2 diagnostics methods, and is a critical mechanism in the functionality of NeuroDetech, Waterloo iGEM's 2021 project.

Documentation: Generally, CRISPR-Cas systems involve a Cas protein and a CRISPR guide RNA (gRNA), where the CRISPR-Cas complex exhibits endonuclease activity. Cas13 is a Type VI Cas protein, which is unique among the Cas family, as it cleaves single-stranded RNA (ssRNA). This is in contrast to Cas9 and Cas12, which target double-stranded DNA (Koonin & Makarova, 2019). Even more notably, upon recognition of its ssRNA target, Cas13 cleaves the target, remains bound, and exhibits nonspecific nuclease activity, indiscriminately cleaving ssRNA other than the target (Koonin & Makarova, 2019).

There are several relatively well-characterized Cas13 proteins that originate from different species of the Leptotrichia genus, such as Cas13a from L. wadei, L. buccalis, and L. shahii. Of these Cas13a variants, L. shahii was the earliest discovered; however, diagnostics tools have favoured L. wadei and L. buccalis for their increased analyte sensitivity. In fact, Fozouni et al. (2020) utilized Cas13a from L. buccalis to detect SAR-CoV-2 RNA, favouring the L. buccalis variant as it had the highest sensitivity compared to the other Cas13a variants (Fozouni et al., 2020). In addition, Cas13a from L. buccalis has been shown to be accurate enough to distinguish even single nucleotide polymorphisms (SNPs) (Fozouni et al., 2020). This makes this part the optimal Leptotrichia-derived Cas13 part for use in diagnostics applications.

Generally, the successful design of CRISPR guide RNA sequences for use with Cas13a requires that the following guidelines be met:

  • CRISPR guide RNA sequences should have a total length of ~64 bp. This is in contrast with Cas9, whose guide RNA sequences can span over 100 bp (Koonin & Makarova, 2019).
  • Of the recommended 64 bp length, 30 bp should be reserved for a stem and hairpin region, which is bound by Cas13a. Fozouni et al. (2020) suggests that the following 30-nucleotide sequence is appropriate as a stem sequence at the 5' end of the CRISPR guide RNA (Fozouni et al., 2020): 5′-GACCACCCCAAAAAUGAAGGGGACUAAAAC-3′
  • The remaining ~34 bp can consist of a complementary RNA sequence to the target ssRNA.

As mentioned, the magic of CRISPR-Cas13a often comes down to its nonspecific RNase activity upon detection of its target ssRNA. In diagnostics applications, a major limitation of utilizing CRISPR-Cas systems is that amplification of the target DNA/RNA must be performed before detection using CRISPR-Cas. A common detection method utilizing this workflow is called SHERLOCK. However, Cas13's nonspecific RNase activity upon target detection inherently allows for the detection of a single molecule of the target RNA to be 'amplified'. In turn, the amplification step before CRISPR-Cas13 detection can effectively be eliminated. This novel method of CRISPR-Cas13 detection, boasting higher sensitivity than the traditional SHERLOCK method, is called SATORI, and it is the crux of the detection of SARS-CoV-2 RNA by Fozouni et al. (2020). Once a sample containing SARS-CoV-2 RNA was added to a solution containing CRISPR-Cas13a as well as a fluorophore and quencher duo, linked by ssRNA, the CRISPR-Cas13a's nonspecific RNase activity was activated by detection of the SARS-CoV-2 RNA. This resulted in the collateral cleavage of the ssRNA linking fluorophores and quenchers, thereby producing fluorescence proportional to the amount of SARS-CoV-2 RNA added (Fozouni et al., 2020).

Waterloo iGEM's 2021 project, NeuroDetech, consisted of a set of microfluidic assay chips designed to quantify ADHD-associated biomarkers and gene markers. Inspired by the work of Fozouni et al. (2020), we adapted the SATORI detection method for the sensitive detection of mRNA containing ADHD-associated mutations in urine samples. A binding molecule, consisting of biotinylated CRIPSR-Cas13a, would bind to the ADHD-associated mRNA transcript in a urine sample. Then, at the test chamber of the microfluidic assay, any unbound CRISPR-Cas13 would bind to molecules of the target RNA conjugated to the test chamber. Subsequent release to the test chamber of fluorophores and quenchers linked by ssRNA would result in fluorescence, where a signal lower than a threshold level would indicate that the patient is likely to have the ADHD-associated mutation. More information can be found on Waterloo iGEM 2021's wiki page: https://2021.igem.org/Team:Waterloo


Contribution (iGEM22_Thessaloniki_Meta)

The existing part that we used for our experiments and we decided to improve is the Cas13a Lbu (BBa_K2926001) designed by iGEM19_Bielefeld-CeBiTec team. This part codes for the Cas13a derived from Leptotrichia buccalis. According to the part’s documentation in the registry the EcoRI and PstI site have been removed to succeed RFC [10] compatibility. This part was used by the Bielefeld-CeBiTec team for assays in S.cerevisiae.

Introduction

A fundamental prerequisite for the practical application of recombinant enzyme-based diagnostic devices is the production of the enzyme in large quantities and in a functional form. However, the protein expression is a complex process which involves hundreds of molecular components and is affected by many variables which need to be optimized for efficient protein production in large quantities (Lipońska et al., 2018). The Cas13a protein derived from Leptotrichia Buccalis has a considerable molecular weight of approximately 138kDA and the effective recombinant Cas13a protein production in Escherichia coli can often be challenging.

Optimization approaches for the protein production can be applied in different steps of the whole process, however we decided to focus our efforts on optimization strategies related with the translation step of protein synthesis. Specifically, two approaches were followed towards protein production optimization. The first strategy or else cis-optimization approach involves the usage of a DNA CDS sequence that is optimal for Cas13a production in E.coli based on codon metrics and codon frequency. The second approach or else trans-optimization involves the incorporation of the SUMO (small ubiquitin-related modifier) protein in fusion with Cas13a protein for efficient protein production in the soluble cytoplasmic function. The addition of the SUMO solubility tag in fusion with the Cas13a, could enhance protein expression and solubility, decrease protein degradation and simplify protein purification (Butt et al., 2005). As described above, two different optimization approaches were followed for the improvement of the part BBa_K2926001:

  • Cis-optimization: codon optimization for efficient Cas13a production in ecoli.
  • Trans-optimization: generate gene chimera for Cas13a production in fusion with SUMO solubility tag.


Cis-optimization: codon optimization for efficient Cas13a production in E.coli.

In the context of synthetic biology, codon optimization is widely used to ameliorate gene expression in heterologous expression systems. Codon optimization is based on the basic principle of the genetic code that the distribution of the 64 unique DNA codons is non-random. Within a genome exist both rare and abundant DNA codons and their distribution varies across all organisms. The host-specific codon usage bias (CUB) influences translation efficiency especially when there is a high dominance of rare codons in the genetic sequence that is intended for translation. A common strategy for common optimization is the replacement of the rare codons with more frequently occurring ones, in accordance with the CUB of the specific organism. Since we decided to express LbuCas13a protein in BL21 (DE3) E.coli strain, we followed a codon optimization approach to achieve maximum protein expression efficiency in the desired E.coli strain.

Trans-optimization: generate gene chimera for Cas13a production in fusion with SUMO solubility tag.

SUMO protein has been previously fused to the N-terminus of several proteins leading to increased expression and solubility of the protein of interest. But how does SUMO protein enhance protein solubility and proper folding? The answer lies in the structure of SUMO protein. Specifically, SUMO has an inner hydrophobic core and an external hydrophilic surface, thus exerts a detergent-like effect in proteins that cannot easily acquire their proper folding. Despite the advantages of SUMO addition, one drawback of this protein expression strategy is the necessary cleavage of the solubility tag. However, many SUMO proteases such as Ulp1, which are members of the cysteine protease superfamily can be used to cleave the SUMO tag without affecting the N-terminus of the desired protein (Panavas et al., 2009). Therefore, by expressing the LbuCas13a protein in fusion with the SUMO-chaperone protein we aim to enhance the quantity of Cas13a protein that accumulates to the soluble cytoplasmic fraction, succeeding proper protein folding and subsequent efficient SUMO tag removal.

Comparative experiments

To demonstrate that our modifications had a positive effect on the efficiency of Cas13a protein production, we conducted comparative protein production experiments between the “improved” LbuCas13a (https://parts.igem.org/Part:BBa_K4170016) and the analogous protein from BBa_K2926001 part. For the implementation of the comparative experiments, we had to replace the “optimized” SUMO-LbuCas13a protein from the pSB1C3 plasmid with the Lbu Cas13a deposited from iGEM19_Bielefeld-CeBiTec team in the registry, keeping constant all the other regulatory elements of the genetic device. The detailed cloning strategy of the LbuCas13a coding device under T7 promoter (https://parts.igem.org/Part:BBa_K4170016) is described on the corresponding part registry page and on the results page of our wiki (https://2022.igem.wiki/thessaloniki-meta/results).

Cloning strategy of Cas13a Lbu (BBa_K2926001) for comparative experiments.

The CDS of Cas13a Lbu (BBa_K2926001) flanked by appropriate recognition sequences of BsaI restriction enzyme was ordered from IDT and cloned downstream of the T7 promoter in pSB1C3 plasmid with Golden Gate assembly. This part is the Cas13a Lbu part. The cloning process is described in detail below:

Step 1. PCR amplification

  • PCR amplification with Ev and Pv standard primers from Basic SevaBrick Assembly (Damalas et al., 2020) using pSB1C3 (Bba_J36400-2022 DNA distribution Kit) a template (Figure 1). This PCR produces the pSB1C3 backbone part ready for Golden Gate assembly.
  • PCR amplification with cas13a T7 P0 FWD and SUMOLESS RVS primers using the LbuCas13a coding device under T7 promoter (BBa_K4170016-link) as a template (Figure 2). This PCR produces the LacI-promoter-RBS part ready for Golden Gate assembly.

Step 2. Golden Gate-based sevaBrick assembly

  • Golden Gate assembly of the PCR amplified LacI-promoter-RBS and Cas13a Lbu parts (BBa_K2926001) along with the ‘linearized’ pSB1C3 backbone part for the efficient construction of the LbuCas13a coding sequence under the transcriptional control of the Lac Repressor.

  • The final plasmid after the Golden Gate assembly contains the same DNA elements/features as the cloned final SUMO-LbuCas13a coding device under T7 promoter (BBa_K4170016), replacing the CDS of the codon-optimized Cas13a with the CDS of Cas13a Lbu (BBa_K2926001). Furthermore, the CDS of the molecular chaperone SUMO sequence has also been removed. In addition, utilizing this cloning strategy we incorporated the 6xHis affinity tag at the N-terminus of the Cas13a Lbu (BBa_K2926001) to facilitate the efficient purification of the protein utilizing a Ni-NTA affinity purification methodology.


    Expression of recombinant LbuCas13a proteins.

    • The procedure of the protein expression initiates with the preparation of the bacterial pre-culture (15ml) incubated overnight at 37 °C. The following day the pre-culture was diluted in 1L of nutrient media, followed by a further incubation at 37°C of the diluted pre-culture until Optical Density (OD600) reached 0.7 – 0.8 (continuous measurements at the photometer at specific time points).
    • To induce LbuCas13a protein expression we added IPTG to the 1L bacterial culture to achieve a final concentration of 1mM. The bacterial culture was then incubated for 6 hours at 37°C. After overnight incubation, the bacterial culture was centrifuged at 10.000 g for 20 min at 4 °C and the supernatant was discarded. The bacterial pellets were resuspended in binding buffer (3oomM NaCl, 50mM NaH2PO4, 10mM imidazole, pH 8) followed by successive freeze-thaw cycles. After the freeze-thaw steps, Lysozyme (100mg/ml) and Triton x-100 were added and ultrasonication was performed to lyse the bacterial membrane. After ultrasonication, DNase (1mg/ml), MgCl2 (8mM) and Protease Inhibitor (PI) were added and the samples were incubated in a cold room for 2 hours on a rotator machine.
    • To obtain the soluble fraction of the protein, refrigerated centrifugation was carried out and the supernatant was then filtered by using 0.22 μm filter units. The remaining pellet constitutes the Inclusion Bodies (IBs), which also contains the insoluble form of the protein of interest. To isolate the SUMO-LbuCas13a protein from the IBs, the bacterial pellet is subjected to successive washing steps using 3 different buffers (A, B, C) followed by ultracentrifugation at 30.000g for 20 min at 4 C. The process is completed by resuspending the protein in L-Arginine solution which promotes the proper folding of the protein restoring its functional quaternary structure.


    SDS-PAGE gel electrophoresis and Western blotting of Cas13a Lbu (BBa_K2926001)

    Equal volumes of protein samples corresponding to the filtered soluble and resuspended insoluble (IBs) solution respectively, were loaded into each well of the SDS-PAGE gel for separation based on molecular weight. After gel electrophoresis completion, suitable images of the gels were obtained. After the separation of the protein mixture through the SDS-PAGE gel electrophoresis, it was transferred to the PVDF membrane for western blotting. After the initial blocking step, the addition of the anti-His primary and the anti-mouse alkaline Phosphatase-Labeled secondary antibody, the protein bands were detected using the alkaline phosphatase detection method.


    photo

    Analyzing the results from the SDS-PAGE gel electrophoresis and the Western Blotting (Figure 3) we can conclude that the Cas13a Lbu (BBa_K2926001) protein is detected only in the insoluble fraction which corresponds to the inclusion bodies of the bacteria. The protein band which corresponds to the LbuCas13a protein is detected at the molecular weight of 130kDa. However, no LbuCas13a protein band is detected at the soluble cytoplasmic fraction. The process of obtaining bioactive functional protein from inclusion bodies is usually labor intensive and the yields of the recovered recombinant protein are often low.


    SDS-PAGE gel electrophoresis and Western blotting of “improved” SUMO-LbuCas13a protein (BBa_K4170016)

    Equal volumes of protein samples corresponding to the filtered soluble and resuspended insoluble (IBs) solution respectively, were loaded into each well of the SDS-PAGE gel for separation based on molecular weight. After gel electrophoresis completion, suitable images of the gels were obtained. After the separation of the protein mixture through the SDS–PAGE gel electrophoresis, it was transferred to the PVDF membrane for western blotting. After the initial blocking step, the addition of the anti-His primary and the anti-mouse alkaline Phosphatase-Labeled secondary antibody, the protein bands were detected using the alkaline phosphatase detection method.

    photo

    Analyzing the results from the SDS-PAGE gel electrophoresis and the Western Blotting (Figure 4) we can conclude that the SUMO-LbuCas13a is detected in both the soluble and insoluble fraction (Inclusion Bodies). The protein band which corresponds to the SUMO-LbuCas13a fusion protein is detected at the molecular weight of 155kDa. Therefore, we can assume that the addition of the SUMO solubility tag enhanced the soluble fraction of the LbuCas13a protein. The purification of soluble proteins is less expensive and time consuming compared to the process needed for protein purification and recovery from inclusion bodies. Utilizing the chaperone-mediated LbuCas13a protein recovery from soluble fraction ensures the integrity of the refolded proteins. The resolubilization procedures required to recover the protein from inclusion bodies can disturb the integrity of the protein. In addition, if we compare the Figures 4 and 5 which correspond to the Cas13a Lbu (BBa_K2926001) and SUMO-LbuCas13a (BBa_K4170016) respectively, we can understand that the codon optimization procedure enhanced the total protein yield in both the soluble and the insoluble fraction of the LbuCas13a protein. Further information about the downstream experiments regarding the SUMO-LbuCas13a purification with His SpinTrap purification columns and the enzymatic removal of the SUMO protein can be found on the results and on the experiments pages.


    References:

    Fozouni, P., Son, S., Derby, M. D. de L., Knott, G. J., Gray, C. N., D’Ambrosio, M. V., Zhao, C., Switz, N. A., Kumar, G. R., Stephens, S. I., Boehm, D., Tsou, C.-L., Shu, J., Bhuiya, A., Armstrong, M., Harris, A. R., Chen, P.-Y., Osterloh, J. M., & Ott, M. (2020, December 4). Amplification-free detection of SARS-COV-2 with CRISPR-CAS13a and mobile phone microscopy. Cell. 184(2), 323-333.e9. https://www.sciencedirect.com/science/article/abs/pii/S0092867420316238.

    Koonin, E. V., & Makarova, K. S. (2019). Origins and evolution of CRISPR-Cas systems. Philosophical Transactions of the Royal Society B: Biological Sciences, 374(1772). https://royalsocietypublishing.org/doi/10.1098/rstb.2018.0087