Difference between revisions of "Part:BBa K200005:Design"
(→Design Notes) |
(→Design Notes) |
||
| Line 8: | Line 8: | ||
Used to resist dessication | Used to resist dessication | ||
| − | Forward: <b>GCTCTAG</b>ATGAGTCGTTTAGTCGTAG 52.4C(without) and 63.2(with) | + | Forward: <b>GCTCTAG</b>ATGAGTCGTTTAGTCGTAG <br> |
| − | Backward: <b>GGACTAGTA</b>CTACGCAAGCTTTGGAAAG 54.5C(without) and 65.1(with) | + | Recomended Temperatures for PCR : 52.4C(without overhang) and 63.2(with overhang)<br><br> |
| + | Backward: <b>GGACTAGTA</b>CTACGCAAGCTTTGGAAAG | ||
| + | Recomended Temperatures for PCR : 54.5C(without overhang) and 65.1(with overhang) | ||
===Source=== | ===Source=== | ||
Revision as of 11:38, 28 August 2009
Status: 500 Content-type: text/html
Software error:
Not enough arguments for Range::range at /websites/parts.igem.org/cgi/lib/Range.pm line 250, near "range;" Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_" syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_" Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288. syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Status: 500
Content-type: text/html
Software error:
Not enough arguments for Range::range at /websites/parts.igem.org/cgi/lib/Range.pm line 250, near "range;" Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_" syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_" Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288. syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Design Notes
Used to resist dessication
Forward: GCTCTAGATGAGTCGTTTAGTCGTAG
Recomended Temperatures for PCR : 52.4C(without overhang) and 63.2(with overhang)
Backward: GGACTAGTACTACGCAAGCTTTGGAAAG
Recomended Temperatures for PCR : 54.5C(without overhang) and 65.1(with overhang)
Source
Escherichia coli. Sourced from ecoliwiki