Difference between revisions of "Part:BBa K4263007"

 
Line 1: Line 1:
 
+
<html lang="en">
__NOTOC__
+
<head>
<partinfo>BBa_K4263007 short</partinfo>
+
  <meta charset="UTF-8">
 
+
  <meta http-equiv="X-UA-Compatible" content="IE=edge">
AACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGGCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAACG
+
  <meta name="viewport" content="width=device-width, initial-scale=1.0">
 
+
  <title>K4263007</title>
<!-- Add more about the biology of this part here
+
  <link rel="stylesheet" href="https://2022.igem.wiki/scut-china/static/css/part-public.css">
===Usage and Biology===
+
</head>
 
+
<body>
<!-- -->
+
  <article>
<span class='h3bb'>Sequence and Features</span>
+
    <h2 style="font-weight: bold;">P<sub>AOX1</sub></h2>
<partinfo>BBa_K4263007 SequenceAndFeatures</partinfo>
+
    <h2>Introduction</h2>
 
+
    <p>AOX1 promoter is a key promoter in the methylotrophic yeast <em>Pichia pastoris</em>.</p>
 
+
    <h2>Characterization</h2>
<!-- Uncomment this to enable Functional Parameter display
+
    <p>In order to test the function of P<em><sub>AOX1</sub></em>, we construct "P<em><sub>AOX1</sub>-EGFP</em>-terminator" (Figure 1). If P<em><sub>AOX1</sub></em> is functional, we can test the fluorescence intensity of EGFP in supernatant samples obtained from the culture of recombinant <em>P.pastoris</em> GS115 strain.</p>
===Functional Parameters===
+
    <img src="https://static.igem.wiki/teams/4263/wiki/parts/image/aox1e-min.jpg" alt="">
<partinfo>BBa_K4263007 parameters</partinfo>
+
    <h4>Figure 1 Gene circuit of P<em><sub>AOX1</sub>-EGFP</em>-terminator</h4>
<!-- -->
+
    <p>Our results matched the general expected trend (Figure 2). After fermentation experiment in BMMY medium containing 1% methanol. The fluorescence intensity of the samples of recombinant <em>P.pastoris</em> GS115 containing the <em>EGFP</em> gene gradually increased over time, which is in line with literature description<sup>[1]</sup>. At the same time, we measured the growth curve of the strains.</p>
 +
    <img src="https://static.igem.wiki/teams/4263/wiki/parts/image/paox1-min.jpg" alt="">
 +
    <h4>Figure 2 Fluorescence intensity and OD600 absorbance of samples obtained at different time points from the culture of corresponding recombinant <em>P.pastoris</em> GS115 containing <em>EGFP</em> gene.</h4>
 +
    <h2>Reference</h2>
 +
    <p>[1] Xuan Y, Zhou X, Zhang W, et al. An upstream activation sequence controls the expression of <em>AOX1</em> gene in Pichia pastoris[J]. FEMS Yeast Res, 2009,9(8):1271-1282.</p>
 +
  </article>
 +
</body>
 +
</html>

Revision as of 15:42, 26 September 2022

K4263007

PAOX1

Introduction

AOX1 promoter is a key promoter in the methylotrophic yeast Pichia pastoris.

Characterization

In order to test the function of PAOX1, we construct "PAOX1-EGFP-terminator" (Figure 1). If PAOX1 is functional, we can test the fluorescence intensity of EGFP in supernatant samples obtained from the culture of recombinant P.pastoris GS115 strain.

Figure 1 Gene circuit of PAOX1-EGFP-terminator

Our results matched the general expected trend (Figure 2). After fermentation experiment in BMMY medium containing 1% methanol. The fluorescence intensity of the samples of recombinant P.pastoris GS115 containing the EGFP gene gradually increased over time, which is in line with literature description[1]. At the same time, we measured the growth curve of the strains.

Figure 2 Fluorescence intensity and OD600 absorbance of samples obtained at different time points from the culture of corresponding recombinant P.pastoris GS115 containing EGFP gene.

Reference

[1] Xuan Y, Zhou X, Zhang W, et al. An upstream activation sequence controls the expression of AOX1 gene in Pichia pastoris[J]. FEMS Yeast Res, 2009,9(8):1271-1282.