Difference between revisions of "Part:BBa K4197022"
Line 4: | Line 4: | ||
Gene coding for dsRFP with ihfB800 promoter | Gene coding for dsRFP with ihfB800 promoter | ||
+ | |||
+ | <html> | ||
+ | |||
+ | <h2>Introduction</h2> | ||
+ | <p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p> | ||
+ | |||
+ | <h2>Construction</h2> | ||
+ | <p>Xxxxx xxxxx xxxxx xxxxxx xxxx</p> | ||
+ | |||
+ | |||
+ | <div class="center"> | ||
+ | <div class="thumb tnone"> | ||
+ | <div class="thumbinner" style="width:50%;"> | ||
+ | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="image"> | ||
+ | <img alt="" src="/wiki/images/7/7e/T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" width="100%" height=auto class="thumbimage" /></a> <div class="thumbcaption"> | ||
+ | <div class="magnify"> | ||
+ | <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a> | ||
+ | </div> | ||
+ | <b>Figure 1: </b> <b>Xxxxxx</b> | ||
+ | Xxxxxxxxxxxxxxxxxxxxxxxxxxx. | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | <h2>Xxxxxxxxx</h2> | ||
+ | <p>Xxxxxxxxxxxxx</p> | ||
+ | <div class="center"> | ||
+ | <div class="thumb tnone"> | ||
+ | <div class="thumbinner" style="width:80%;"> | ||
+ | <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="image"> | ||
+ | <img alt="" src="https://static.igem.org/mediawiki/2018/5/5b/T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" width="100%" height=auto class="thumbimage" /></a> <div class="thumbcaption"> | ||
+ | <div class="magnify"> | ||
+ | <a href="http://2018.igem.org/File:T--Toulouse-INSA-UPS--Team--Callum-Model-5step_dist.gif" class="internal" title="Enlarge"></a> | ||
+ | </div> | ||
+ | <b>Figure 2: </b> <b>Xxxxxxxxxxxxx</b> | ||
+ | Xxxxxxxxxxxxx. | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | |||
+ | <h2>titre 2</h2> | ||
+ | <h3>Titre 3</h3> | ||
+ | <p>Xxxxxxxxxx</p> | ||
+ | <ul> | ||
+ | <li>Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC</li> | ||
+ | <li>Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG</li> | ||
+ | </ul> | ||
+ | <p>Xxxxxxxxxx</p> | ||
+ | <ul> | ||
+ | <li>CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC</li> | ||
+ | <li>Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG</li> | ||
+ | </ul> | ||
+ | |||
+ | |||
+ | <h3>titre 3</h3> | ||
+ | <h4>Titre 4</h4> | ||
+ | <p>Xxxxxx</p> | ||
+ | |||
+ | |||
+ | <h4>Titre 4</h4> | ||
+ | <p>xxxxxxx</p> | ||
+ | |||
+ | <h2>Titre 2</h2> | ||
+ | <p>Xxxxxx</p> | ||
+ | <h2>References</h2> | ||
+ | <ol> | ||
+ | <i> | ||
+ | <li>Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.</li> | ||
+ | <li>Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.</li> | ||
+ | <li>Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.</li> | ||
+ | </i> | ||
+ | </ol> | ||
+ | </html> | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here |
Revision as of 18:14, 24 September 2022
mSCARLET-I under control of ihfB800 promoter
Gene coding for dsRFP with ihfB800 promoter
Introduction
Xxxxx xxxxx xxxxx xxxxxx xxxx
Construction
Xxxxx xxxxx xxxxx xxxxxx xxxx
Xxxxxxxxx
Xxxxxxxxxxxxx
titre 2
Titre 3
Xxxxxxxxxx
- Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
- Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG
Xxxxxxxxxx
- CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
- Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG
titre 3
Titre 4
Xxxxxx
Titre 4
xxxxxxx
Titre 2
Xxxxxx
References
- Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
- Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
- Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.
Sequence and Features
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1520
Illegal XbaI site found at 1505
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1520
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal NotI site found at 1512 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1520
- 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1520
Illegal XbaI site found at 1505
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1520
Illegal XbaI site found at 1505
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal AgeI site found at 329
Illegal AgeI site found at 1475 - 1000COMPATIBLE WITH RFC[1000]