Difference between revisions of "Part:BBa K3905017"

 
Line 3: Line 3:
 
<partinfo>BBa_K3905017 short</partinfo>
 
<partinfo>BBa_K3905017 short</partinfo>
  
−
Amplification probe required for the isothermal amplification of miRNA using Recombinase polymerase amplification. RPA of the miRNA required the design of the 517-5 T7p* Probe 1. Probe 1 binds to the 5' end of the miRNA. This probe is phosphorylated on its 5' end. Through phosphorylation, DNA ligase is able to ligate 517-5 T7p* Probe 1 to 517-5 T7p* Probe 1. Allowing RPA to occur for the formation of DNA. For this to occur, the forward primer 5' AACCAGCCACAAACATAATACGACTC 3' is added, which binds to this probe.  
+
<h4>This is one of the two probes required for the isothermal amplification of miR-517-5p. </h4>
 +
 
 +
<h2> How our miRPA works </h2>
 +
 
 +
<html>
 +
<centre>
 +
<figure>
 +
<img width="500px" src="https://2021.igem.org/wiki/images/1/1b/T--City_of_London_UK--RPA2.png">
 +
</figure>
 +
</centre>
 +
</html>
 +
<html>
 +
<centre>
 +
<figure>
 +
<img width="400px" src="https://2021.igem.org/wiki/images/8/8e/T--City_of_London_UK--RPA3.png">
 +
</figure>
 +
</centre>
 +
</html>
 +
 
 +
As seen in the diagram above, two DNA probes, one with 5’ phosphorylation, bind to the miRNA, and are ligated together by DNA ligase. Then, primers are added, with DNA polymerase, and complementary strands to the ligated probes are synthesised. Then, RPA can take place: primers, associated with recombinase protein so they can dislodge the strands, replicating them in a similar method to PCR, but as no heat cycles are required to break up the strands, the process can take place isothermally.
 +
 
 +
 
 +
<html>
 +
<centre>
 +
<figure>
 +
<img width="600px" src="https://2021.igem.org/wiki/images/c/cf/T--City_of_London_UK--RPA4.png">
 +
</figure>
 +
</centre>
 +
</html>
 +
 
 +
In order for the miRNA to be detected, we decided to use ‘asymmetric RPA’: an excess of forward primers are added (usually 5x the amount), so an excess of the strand that was originally miRNA form, so there is now ssDNA with the miRNA code in DNA. This can be detected by our toehold switches.
 +
 
 +
 
 +
<html>
 +
<centre>
 +
<figure>
 +
<img width="600px" src="https://2021.igem.org/wiki/images/7/75/T--City_of_London_UK--RPA5.png">
 +
</figure>
 +
</centre>
 +
</html>
 +
 
 +
 
 +
<html>
 +
<centre>
 +
<figure>
 +
<img width="600px" src="https://2021.igem.org/wiki/images/5/59/T--City_of_London_UK--RPA6.png">
 +
</figure>
 +
</centre>
 +
</html>
 +
 
 +
<h2> Characterisation </h2>
 +
<h3> Introduction </h3>
 +
To show that miRPA can amplify our miRNA whilst discriminating between our desired miRNA and homologous miRNAs, we tested our trigger miRNA with their respective closest homologs, as determined by our software tool.
 +
 
 +
<h3> Methodology </h3>
 +
We ordered our probes and primers on IDT and then resuspended them in a TE buffer and added them to our trigger and homologous miRNAs, with DNA ligase to bind the probes together. We amplified the miRPA product with PCR. We then ran a gel electrophoresis on the miRPA products.
 +
 
 +
<h3> Results </h3>
 +
<html>
 +
<centre>
 +
<figure>
 +
<img width="400px" src="https://2021.igem.org/wiki/images/f/f2/T--City_of_London_UK--GE.png">
 +
</figure>
 +
</centre>
 +
</html>
 +
 
 +
We did not have access to gel ladders which could discriminate between <100bp DNA strands, but our gel showed that the target miRNA, miR-517-5p was amplified and more so than the homologs. Furthermore, the fact that the homologs moved further through the gel suggested that the probes had not bound together, which would suggest the probes and homologous RNAs did not bind together.
 +
 
 +
<h3> Conclusion </h3>
 +
Using miRPA in our test would allow us to ensure there is an adequate miRNA concentration, and our characterisation of the technique showed it is specific to our miRNAs.
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Revision as of 21:48, 21 October 2021


517-5 T7p* Probe 1

This is one of the two probes required for the isothermal amplification of miR-517-5p.

How our miRPA works

As seen in the diagram above, two DNA probes, one with 5’ phosphorylation, bind to the miRNA, and are ligated together by DNA ligase. Then, primers are added, with DNA polymerase, and complementary strands to the ligated probes are synthesised. Then, RPA can take place: primers, associated with recombinase protein so they can dislodge the strands, replicating them in a similar method to PCR, but as no heat cycles are required to break up the strands, the process can take place isothermally.


In order for the miRNA to be detected, we decided to use ‘asymmetric RPA’: an excess of forward primers are added (usually 5x the amount), so an excess of the strand that was originally miRNA form, so there is now ssDNA with the miRNA code in DNA. This can be detected by our toehold switches.



Characterisation

Introduction

To show that miRPA can amplify our miRNA whilst discriminating between our desired miRNA and homologous miRNAs, we tested our trigger miRNA with their respective closest homologs, as determined by our software tool.

Methodology

We ordered our probes and primers on IDT and then resuspended them in a TE buffer and added them to our trigger and homologous miRNAs, with DNA ligase to bind the probes together. We amplified the miRPA product with PCR. We then ran a gel electrophoresis on the miRPA products.

Results

We did not have access to gel ladders which could discriminate between <100bp DNA strands, but our gel showed that the target miRNA, miR-517-5p was amplified and more so than the homologs. Furthermore, the fact that the homologs moved further through the gel suggested that the probes had not bound together, which would suggest the probes and homologous RNAs did not bind together.

Conclusion

Using miRPA in our test would allow us to ensure there is an adequate miRNA concentration, and our characterisation of the technique showed it is specific to our miRNAs.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 4
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 4
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 4
  • 1000
    COMPATIBLE WITH RFC[1000]