Difference between revisions of "Part:BBa K3905013"

Revision as of 19:38, 21 October 2021

517-5 Probe 1

Sequence and Features

Assembly Compatibility:

@@ Line 3: / Line 3: @@
 <partinfo>BBa_K3905013 short</partinfo>
-Amplification probe required for the isothermal amplification of miRNA using Recombinase polymerase amplification. RPA of the miRNA required the design of the 517-5 Probe 1. Probe 1 binds to the 5' end of the miRNA. This probe is phosphorylated on its 5' end. Through phosphorylation, DNA ligase is able to ligate 517-5 Probe 1 to 517-5 Probe 2. Allowing RPA to occur for the formation of DNA. For this to occur, the forward primer
+<h2> How our miRPA works </h2>
-' AACCAGCCACAAACATAATACGACTC 3' is added, which binds to this probe.
 <!-- Add more about the biology of this part here
 ===Usage and Biology===