Difference between revisions of "Part:BBa K3790004"
TiTong Fudan (Talk | contribs) (→Experimental Results) |
TiTong Fudan (Talk | contribs) (→Reference) |
||
Line 28: | Line 28: | ||
<span class='h3bb'>Sequence and Features</span> | <span class='h3bb'>Sequence and Features</span> | ||
<partinfo>BBa_K3790004 SequenceAndFeatures</partinfo> | <partinfo>BBa_K3790004 SequenceAndFeatures</partinfo> | ||
− | + | AGCAGCGGTACACCGACACCGAGCAATGTTGTTCTGATTGGTAAAAAGCCGGTGATGAATTATGTTCTGGCAGCACTGACCCTGCTGAATCAGGGTGTTAGCGAAATTGTTATTAAAGCACGTGGTCGTGCAATTAGCAAAGCAGTTGATACCGTTGAAATTGTGCGTAATCGTTTTCTGCCGGATAAGATCGAAATTAAAGAAATTCGTGTTGGTAGCCAGGTTGTTACCAGCCAGGATGGTCGTCAGAGCCGTGTTAGCACCATTGAAATTGCCATTCGCAAAAAG | |
<!-- Uncomment this to enable Functional Parameter display | <!-- Uncomment this to enable Functional Parameter display | ||
Line 34: | Line 34: | ||
<partinfo>BBa_K3790004 parameters</partinfo> | <partinfo>BBa_K3790004 parameters</partinfo> | ||
<!-- --> | <!-- --> | ||
+ | Jiang G , Pei Y , Wang Z . A NOVEL CONTROL STRATEGY FOR SINUSIODAL WAVE INVERTER WITH PI REGULATORS AND CAPACITOR CURRENT FEEDBACK[J]. Journal of Xian Medical University, 2003, 15(1):p.20-24,58. | ||
+ | Kalichuk, V., Béhar, G., Renodon-Cornière, A. et al. The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family. Sci Rep 6, 37274 (2016). https://doi.org/10.1038/srep37274 | ||
+ | Cao S-C, Qiu L-Z. Study of DNA binding protein DbpA affecting the performance of DNA polymerase[J]. Journal of Fudan:Natural Science Edition, 2015, 54(4):469-477. |
Revision as of 01:51, 21 October 2021
albA1
Introduction
albA1 is a double-stranded binding protein from the same species as Sso7d, Sulfolobus solfataricus, which is close to Sso7d in length and structure. So we speculate that it may have a similar function to enhance DNA polymerase activity as Sso7d.
Usage and Biology
Sso7d is a double-stranded binding protein that is linked to DNA polymerase A or DNA polymerase B to produce a fusion protein with higher synthetic efficiency compared to wild-type DNA polymerase. albA1 is a double-stranded binding protein from the same species as Sso7d, Sulfolobus solfataricus, which is close to Sso7d in length and structure, so we speculate that it may be related to Sso7d, so we speculate that it may have a similar function to enhance DNA polymerase activity as Sso7d. The Bst Pol selected for this experiment was DNA polymerase Ⅰ, and no previous studies have focused on whether double-stranded binding proteins can enhance the activity of DNA polymerase Ⅰ. However, we ventured to guess that the double-stranded binding protein could enhance the related activity of DNA polymerase Ⅰ, and performed the next validation experiments.
Experimental Results
Since the length of the albA1 fragment is less than 500bp, we chose to synthesize the sequence ourselves by Oligo assembly by Phanta polymerase. We obtained the relevant sequence information from ncbi and designed synthetic primers for synthesis File:T--Fudan--Oligo assembly by Taq polymerase.jpg\Figure.1 Oligo assembly by Phanta polymerase
The molecular weight of the albA1 DNA was 288 bp, which is approximately 300 bp after adding homology arms to both ends by PCR reaction. We isolated the DNA of interest by gel recovery for subsequent ligation reactions. File:T--Fudan--albA1-S.ssb-E.ssb.jpg\Figure.2 T--Fudan--albA1-S.ssb-E.ssb.jpg
Reference
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
AGCAGCGGTACACCGACACCGAGCAATGTTGTTCTGATTGGTAAAAAGCCGGTGATGAATTATGTTCTGGCAGCACTGACCCTGCTGAATCAGGGTGTTAGCGAAATTGTTATTAAAGCACGTGGTCGTGCAATTAGCAAAGCAGTTGATACCGTTGAAATTGTGCGTAATCGTTTTCTGCCGGATAAGATCGAAATTAAAGAAATTCGTGTTGGTAGCCAGGTTGTTACCAGCCAGGATGGTCGTCAGAGCCGTGTTAGCACCATTGAAATTGCCATTCGCAAAAAG
Jiang G , Pei Y , Wang Z . A NOVEL CONTROL STRATEGY FOR SINUSIODAL WAVE INVERTER WITH PI REGULATORS AND CAPACITOR CURRENT FEEDBACK[J]. Journal of Xian Medical University, 2003, 15(1):p.20-24,58. Kalichuk, V., Béhar, G., Renodon-Cornière, A. et al. The archaeal “7 kDa DNA-binding” proteins: extended characterization of an old gifted family. Sci Rep 6, 37274 (2016). https://doi.org/10.1038/srep37274 Cao S-C, Qiu L-Z. Study of DNA binding protein DbpA affecting the performance of DNA polymerase[J]. Journal of Fudan:Natural Science Edition, 2015, 54(4):469-477.