Difference between revisions of "Promoters/Catalog/Eukaryotic/Repressible"

Latest revision as of 04:05, 17 May 2009

All the promoters on this page are eukaryotic promoters that are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters. Note that negatively regulated yeast promoters have their own page.

*More...*
Name	Description	Promoter Sequence	Length	Doc	Status
BBa_I756015	CMV Promoter with lac operator sites	. . . ttagtgaaccgtcagatcactagtctgcag	663	1278	Not in stock
BBa_I756016	CMV-tet promoter	. . . ttagtgaaccgtcagatcactagtctgcag	610	1250	Not in stock
BBa_I756017	U6 promoter with tet operators	. . . ggaaaggacgaaacaccgactagtctgcag	341	1250	Not in stock
BBa_I756018	Lambda Operator in SV-40 intron	. . . attgtttgtgtattttagactagtctgcag	411	1253	Not in stock
BBa_I756019	Lac Operator in SV-40 intron	. . . attgtttgtgtattttagactagtctgcag	444	1244	Not in stock
BBa_I756020	Tet Operator in SV-40 intron	. . . attgtttgtgtattttagactagtctgcag	391	1244	Not in stock
BBa_I756021	CMV promoter with Lambda Operator	. . . ttagtgaaccgtcagatcactagtctgcag	630	1259	Not in stock

@@ Line 1: / Line 1: @@
 [[Image:NegativePromoter.png|right|200px]]
-All the promoters on this page are ''E. coli'' promoters that are '''negatively regulated''' meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.  Note that constitutive yeast promoters have their own [[Promoters/Catalog/Yeast/Constitutive|page]].
+All the promoters on this page are eukaryotic promoters that are '''negatively regulated''' meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.  Note that negatively regulated yeast promoters have their own [[Promoters/Catalog/Yeast/Negative|page]].
 <br style="clear:both" />
 <parttable>promoter_eukaryote_miscellaneous_negative</parttable>