Difference between revisions of "Part:BBa M10024:Design"
(→‎Design Notes)
Line 12: Line 12:
 
This part includes 4 additional base pairs upstream of the start codon. This is the preferred way of encoding the RBS/CDS junctions.
 
This part includes 4 additional base pairs upstream of the start codon. This is the preferred way of encoding the RBS/CDS junctions.
 
<pre>
 
<pre>
−
Construction of {a~Inv-native>} basic part
+
Construction of {a~Int-native>} basic part
 
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7    (146 bp, gp = A)
 
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7    (146 bp, gp = A)
 
PCR Bhs002F/Bhs003R on E. coli strain 0157:H7    (1889 bp, gp = B)
 
PCR Bhs002F/Bhs003R on E. coli strain 0157:H7    (1889 bp, gp = B)
Line 18: Line 18:
 
PCR Bhs001F/Bhs003R on A+B                      (2009 bp, EcoRI/BamHI)
 
PCR Bhs001F/Bhs003R on A+B                      (2009 bp, EcoRI/BamHI)
 
Digest pBca9495CA-Bca1144#5                      (EcoRI/BamHI, 3039+910, L)
 
Digest pBca9495CA-Bca1144#5                      (EcoRI/BamHI, 3039+910, L)
−
Product is pBca9495CA-M10024                    {a~Inv-native>}
+
Product is pBca9495CA-M10024                    {a~Int-native>}
 
----------------------------
 
----------------------------
−
Bhs001F  Forward EcoRI for {a~Inv-native>}          cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
+
Bhs001F  Forward EcoRI for {a~Int-native>}          cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
−
Bhs002F  Removing the EcoRI site from {a~Inv-native>}  GTTAATCAGAACTCATTTGCAAATGG
+
Bhs002F  Removing the EcoRI site from {a~Int-native>}  GTTAATCAGAACTCATTTGCAAATGG
−
Bhs002R  Removing the EcoRI site from {a~Inv-native>}  CCATTTGCAAATGAGTTCTGATTAAC
+
Bhs002R  Removing the EcoRI site from {a~Int-native>}  CCATTTGCAAATGAGTTCTGATTAAC
−
Bhs003R  Reverse BamHI for {a~Inv-native>}          GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC
+
Bhs003R  Reverse BamHI for {a~Int-native>}          GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC
 
</pre>
 
</pre>
  

Revision as of 22:26, 10 May 2009

{a~Int-native>} Intimin (native)


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 405
    Illegal PstI site found at 653
    Illegal PstI site found at 1100
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 405
    Illegal PstI site found at 653
    Illegal PstI site found at 1100
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 405
    Illegal PstI site found at 653
    Illegal PstI site found at 1100
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 405
    Illegal PstI site found at 653
    Illegal PstI site found at 1100
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 1248


Design Notes

This part follows the BglBricks standard. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BglBricks Standard is available at:
[http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BglBricks Format]

This part includes 4 additional base pairs upstream of the start codon. This is the preferred way of encoding the RBS/CDS junctions. 

Construction of {a~Int-native>} basic part
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7     (146 bp, gp = A)
PCR Bhs002F/Bhs003R on E. coli strain 0157:H7     (1889 bp, gp = B)
----------------------------
PCR Bhs001F/Bhs003R on A+B                       (2009 bp, EcoRI/BamHI)
Digest pBca9495CA-Bca1144#5                      (EcoRI/BamHI, 3039+910, L)
Product is pBca9495CA-M10024                     {a~Int-native>}
----------------------------
Bhs001F  Forward EcoRI for {a~Int-native>}          cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG
Bhs002F  Removing the EcoRI site from {a~Int-native>}   GTTAATCAGAACTCATTTGCAAATGG
Bhs002R  Removing the EcoRI site from {a~Int-native>}  CCATTTGCAAATGAGTTCTGATTAAC
Bhs003R  Reverse BamHI for {a~Int-native>}          GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC

Source

Genomic sequence of E. coli strain 0157:H7

References