Difference between revisions of "Part:BBa M10024:Design"
(→Design Notes) |
|||
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
+ | This part follows the BglBricks standard. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BglBricks Standard is available at: <br> | ||
+ | [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BglBricks Format] | ||
+ | |||
+ | ---- | ||
+ | |||
+ | |||
<pre> | <pre> | ||
Construction of {a~Inv-native>} basic part | Construction of {a~Inv-native>} basic part |
Revision as of 02:30, 10 May 2009
{a~Int-native>} Intimin (native)
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 405
Illegal PstI site found at 653
Illegal PstI site found at 1100 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 405
Illegal PstI site found at 653
Illegal PstI site found at 1100 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 405
Illegal PstI site found at 653
Illegal PstI site found at 1100 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 405
Illegal PstI site found at 653
Illegal PstI site found at 1100 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 1248
Design Notes
This part follows the BglBricks standard. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BglBricks Standard is available at:
[http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BglBricks Format]
Construction of {a~Inv-native>} basic part PCR Bhs001F/Bhs002R on E. coli strain 0157:H7 (146 bp, gp = A) PCR Bhs002F/Bhs003R on E. coli strain 0157:H7 (1889 bp, gp = B) ---------------------------- PCR Bhs001F/Bhs003R on A+B (2009 bp, EcoRI/BamHI) Digest pBca9495CA-Bca1144#5 (EcoRI/BamHI, 3039+910, L) Product is pBca9495CA-M10024 {a~Inv-native>} ---------------------------- Bhs001F Forward EcoRI for {a~Inv-native>} cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG Bhs002F Removing the EcoRI site from {a~Inv-native>} GTTAATCAGAACTCATTTGCAAATGG Bhs002R Removing the EcoRI site from {a~Inv-native>} CCATTTGCAAATGAGTTCTGATTAAC Bhs003R Reverse BamHI for {a~Inv-native>} GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC
Source
Genomic sequence of E. coli strain 0157:H7