Difference between revisions of "Part:BBa M10024:Design"
(→Design Notes) |
|||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_M10024 short</partinfo> | <partinfo>BBa_M10024 short</partinfo> | ||
<partinfo>BBa_M10024 SequenceAndFeatures</partinfo> | <partinfo>BBa_M10024 SequenceAndFeatures</partinfo> | ||
+ | |||
===Design Notes=== | ===Design Notes=== | ||
+ | <pre> | ||
Construction of {a~Inv-native>} basic part | Construction of {a~Inv-native>} basic part | ||
PCR Bhs001F/Bhs002R on E. coli strain 0157:H7 (146 bp, gp = A) | PCR Bhs001F/Bhs002R on E. coli strain 0157:H7 (146 bp, gp = A) | ||
Line 19: | Line 20: | ||
Bhs002R Removing the EcoRI site from {a~Inv-native>} CCATTTGCAAATGAGTTCTGATTAAC | Bhs002R Removing the EcoRI site from {a~Inv-native>} CCATTTGCAAATGAGTTCTGATTAAC | ||
Bhs003R Reverse BamHI for {a~Inv-native>} GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC | Bhs003R Reverse BamHI for {a~Inv-native>} GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC | ||
− | + | </pre> | |
− | + | ||
− | + | ||
===Source=== | ===Source=== |
Revision as of 02:25, 10 May 2009
{a~Int-native>} Intimin (native)
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 405
Illegal PstI site found at 653
Illegal PstI site found at 1100 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 405
Illegal PstI site found at 653
Illegal PstI site found at 1100 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 405
Illegal PstI site found at 653
Illegal PstI site found at 1100 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 405
Illegal PstI site found at 653
Illegal PstI site found at 1100 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 1248
Design Notes
Construction of {a~Inv-native>} basic part PCR Bhs001F/Bhs002R on E. coli strain 0157:H7 (146 bp, gp = A) PCR Bhs002F/Bhs003R on E. coli strain 0157:H7 (1889 bp, gp = B) ---------------------------- PCR Bhs001F/Bhs003R on A+B (2009 bp, EcoRI/BamHI) Digest pBca9495CA-Bca1144#5 (EcoRI/BamHI, 3039+910, L) Product is pBca9495CA-M10024 {a~Inv-native>} ---------------------------- Bhs001F Forward EcoRI for {a~Inv-native>} cccaaGAATTCatgAGATCTtaacATGATTACTCATGGTTG Bhs002F Removing the EcoRI site from {a~Inv-native>} GTTAATCAGAACTCATTTGCAAATGG Bhs002R Removing the EcoRI site from {a~Inv-native>} CCATTTGCAAATGAGTTCTGATTAAC Bhs003R Reverse BamHI for {a~Inv-native>} GCAAAggatccGGCCTTGGTTTGATCAAAAAATATAACCGCAC
Source
Genomic sequence of E. coli strain 0157:H7