Difference between revisions of "Part:BBa K3970020"

Revision as of 14:07, 14 October 2021

pGAP-CpcA-tADH1-pGAP-PcyA-tADH1

Usage and Biology

CpcA gene encodes α-phycocyanin, a light-harvesting photosynthetic bile pigment-protein from the phycobiliprotein complex (phycobilisome, PBS). Phycocyanin is the major phycobiliprotein in the PBS rod.

Gene PcyA encodes ferredoxin oxidoreductase, which catalyzes the four-electron reduction of biliverdin IX-alpha (2-electron reduction at both the A and D rings) and then form (2R,3Z)-phycocyanobilin:

biliverdin IX-alpha + 4 H+ + 4 reduced [2Fe-2S]-[ferredoxin] = biliverdin IX-alpha + 4 oxidized [2Fe-2S]-[ferredoxin]

Construction

For yeast is a kind of eukaryote, each gene need one primer and one terminator to construct the expression cassette. For pcyA, we use primer GAP and terminator ADH1. We get the gene sequence of pcyA and cpcA from Genscript who helped us synthesized the interest sequence. The GAP promoter is originally on the plasmid pTDH3-dCAS9 and also the terminator is originally on the plasmid p426 and plasmid pTDH3. We use related primer to cut them down and re-construct them with pcyA and cpcA.

The construction procedure is that we separately synthesized expression cassette pcyA and cpcA with primer and terminator. Then we insert the two expression cassette into the plasmid p426

Primers we use to construct cpcA pcyA expression cassette:
cpcA pcyA

XbaI-GAP-up (48-mer): tcgctccccatttctctagtcattatcaatactgccatttcaaagaat

GAP-cpcA-dn (40-mer): ttcggtgataggggtcttcatggtggcgagatctaattcg

ADH1-up (30-mer): gcgaatttcttatgatttatgatttttatt

ADH1-XbaI-dn (33-mer): cgaactctgcagtcttatatgccggtagaggtg

XbaI-GAP-up (48-mer): tcgctccccatttctctagtcattatcaatactgccatttcaaagaat

cpcA-up (23-mer): atgaagacccctatcaccgaagc

cpcA-ADH1-dn (41-mer): tcataaatcataagaaattcgctcaggatagagcattgata

Experiment results

The fragment pcyA is on the p426 big fragment for the gene was synthesized to that plasmid and the experimental pictures shows how we recycle the fragment of ADH1 terminator and the big fragment of p426 plasmid.

( note that how we recycle the GAP promoter and the gene cpcaA has been shown on the last part.)

The fragments of the constructed plasmid were recovered

M: Marker
1-4: ADH1(terminator)

The fragments of the constructed plasmid were recovered

Sequence and Features