Revision as of 05:46, 13 October 2021

Hypermethylated region of TFPI2

The sequence of Hypermethylated region of TFPI2.We use this part for detection of colorectal cancer (CRC).

Sequence and Features

Usage and Biology

In our project, the trigger sequence is linked to this part by DNA amplification and was added into the cell free system together with the plasmid contain toehold sequence, the report fluorescent protein will be expressed. The visible color and fluorescent signal can indicate the methylation degree of the TFPI2 gene in CRC patients.

Results

1. PCR verification

1.1 primer design

We plan to use the In Vitro protein expression system to detect the methylation degree of the TFPI2 gene in colorectal cancer patients. According to the literature, we designed methylation-specific primers forTFPI2. In order to express in vitro, T7 promoter and trigger sequence were added to the 5 'end of TFPI methylation forward and reverse primers, respectively. For normalization，we also designed unmethylated primers for the internal reference gene ACTB. Same as TFPI2, T7 promoter sequence was added to its forward primer, trigger primer sequence was added to its reverse primer, and a new primer was synthesized respectively.

TFPI2-M: methylation specific primer

T7-TFPI2-F：TAATACGACTCACTATAGGGCGCGGAGATTTTTTGT

Trigger-TFPI2-R：TATGTAATTGATTTGGCTTCTGTTAGTTTCATATTTAACAAACATCGTCGCAAACCTC

ACTB-NM: unmethylated primer

T7-ACTB-F：TAATACGACTCACTATAGGGGGCACCCAGCACAATGAAG

Trigger-ACTB-R：TATGTAATTGATTTGGCTTCTGTTAGTTTCATACTCGTCATACTCCTGCTTGCTG

1.2 PCR verification

Using human species genome DNA and simulated colorectal cancer genome DNA as templates, PCR amplification were carried out on PCR instrument with the same number of gene amplification cycles, and then verified by agarose gel electrophoresis. From the figure below, we can see that ACTB as an internal control has the same expression in both negative and positive samples, while TFPI2, as a biomarker of colorectal cancer, has a weak band (almost invisible) in negative sample and a significant band in positive sample. Which means that the TFPI2 methylation degree has a significant differences between negative and positive samples. This confirms our conjecture that TFPI2 can be used as a biomarker for colorectal cancer detection, and there are significant differences in negative and positive samples.

Figure3: TFPI2 colorectal cancer detection (PCR verification). A: PCR products were detected by agarose gel electrophoresis; Marker：50bp DNA Ladder，Line 1: negative colorectal cancer specimen with ACTB non-methylation specific primers，Line 2: negative colorectal cancer samples with TFPI2 methylation specific primers，Line 3: positive colorectal cancer samples with ACTB non-methylation specific primers，Line 4: positive colorectal cancer samples with TFPI2 methylation specific primers B: qPCR experimental results analysis.

1.3 Conclusion:

The results were as anticipated: for methylation detection of TFPI2, band was almost invisible in negative colorectal cancer samples, and obvious bands were found in positive samples. The result shows that our parts can work as expected.