Difference between revisions of "Part:BBa K3930026"
Line 10: Line 10:
 
<p><b>The pCONCOMBRE part (BBa_K3930026) enables the production of 3,6-nonadienal from linolenic and linoleic acids, and is composed by:</b></p>
 
<p><b>The pCONCOMBRE part (BBa_K3930026) enables the production of 3,6-nonadienal from linolenic and linoleic acids, and is composed by:</b></p>
 
<p>- the RA (BBa_K3930027) and LA (BBa_K3930028) integration sites in the NSI locus of the <i>S.elongatus</i> genome (based on the plasmid pAM4951 from Easyclone Marker free kit (Taton et al. 2014))</p>
 
<p>- the RA (BBa_K3930027) and LA (BBa_K3930028) integration sites in the NSI locus of the <i>S.elongatus</i> genome (based on the plasmid pAM4951 from Easyclone Marker free kit (Taton et al. 2014))</p>
−
<p>- the <i>Nb-9-LOX</i> (BBa_K3930030), <i>Cm-9-HPL</i> (BBa_K3930031) and LacI genes (Part:BBa_C0012), for the production of 3,6-nonadienal and LacI repressor. The sequences of the Nb-9-LOX and the Cm-9-HPL were codon optimized for an expression into <i>S.elongatus</i>
+
<p>- the <i>Nb-9-LOX</i> (BBa_K3930030), <i>Cm-9-HPL</i> (BBa_K3930031) and <i>LacI</i> genes (Part:BBa_C0012), for the production of 3,6-nonadienal and LacI repressor. The sequences of the Nb-9-LOX and the Cm-9-HPL were codon optimized for an expression into <i>S.elongatus</i>
 
<p>- the inducible promoters Trc-theoE-riboswitch (BBa_K3930029) with IPTG and theophylline, driving the expression of Nb-9-LOX and Cm-9-HPL</p>
 
<p>- the inducible promoters Trc-theoE-riboswitch (BBa_K3930029) with IPTG and theophylline, driving the expression of Nb-9-LOX and Cm-9-HPL</p>
 
<p>- the resistance marker SpecR (BBa_K3930032) to select for Cyanobacteria integrants</p>
 
<p>- the resistance marker SpecR (BBa_K3930032) to select for Cyanobacteria integrants</p>
  
 
<h2>Construction</h2>
 
<h2>Construction</h2>
−
<p>IDT and Twist Bioscience performed the DNA synthesis and delivered the part as gBlock.  The construct was cloned with an In-Fusion Takara kit into the pCfB3032 plasmid and then transformed into <i>E.coli</i> Dh5&alpha; strain. Figure 1 shows the restriction map of the resulting clones. The expected restriction profile was obtained for clone 3.</p>
+
<p>IDT performed the DNA synthesis and delivered the part as gBlock.  The construct was cloned with an In-Fusion Takara kit into the pAM4951 plasmid and then transformed into <i>E.coli</i> Dh5&alpha; strain. Figure 1 shows the restriction map of the resulting clones. The expected restriction profile was obtained for clone A5.</p>
 
      
 
      
  
Line 27: Line 27:
 
                         <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
 
                         <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
 
                     </div>
 
                     </div>
−
                     <b>Figure 1: pFRAMBOISE-notfused assembly</b>
+
                     <b>Figure 1: pCONCOMBRE assembly</b>
−
                     <p>pFRAMBOISE restriction profile from clone 3 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel)</p>
+
                     <p>pCONCOMBRE restriction profile from clone A5 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel)</p>
 
                 </div>
 
                 </div>
 
             </div>
 
             </div>
Line 34: Line 34:
 
     </div>
 
     </div>
 
<br>
 
<br>
−
<p>The plasmid containing the pFRAMBOISE-notfused construct was then linearized with the F and R linearization primers pFRAMBOISE. Then the amplicon was integrated into the genome of our LycoYeast strain with the Takara Yeast transformation protocol. Figure 2 shows the electrophoresis gel of PCR on colony to verify clones.The expected size was obtained for clone D2.</p>
+
<p>The plasmid containing the pCONCOMBRE construct was then linearized with the F and R linearization primers pCONCOMBRE. Then the amplicon was integrated into the genome of <i>S.elongatus</i> strain with the traparental conjugation protocol of Gale et al. (2019). Figure 2 shows the electrophoresis gel of PCR on colony to verify clones. The expected sizes were obtained for clone 4, but one amplicon (LA) had not the right size.</p>
−
<p><b>Primer used to clone this part in the pCfB3032:</b></p>
+
−
<ul>
+
−
    <li>pFRAMBOISE_pCfB3032_Forward : 5' acaggcaatactctgcag 3' </li>
+
−
    <li>pFRAMBOISE_pCfB3032_Reverse : 5' tctctagaaagtataggaacttcac 3'</li>
+
−
</ul>
+
 
<br>
 
<br>
 
<div class="center">
 
<div class="center">
Line 49: Line 44:
 
                     <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
 
                     <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusCloning.png" class="internal" title="Enlarge"></a>
 
                 </div>
 
                 </div>
−
                 <b>Figure 2: </b> <b> Integration of pFRAMBOISE-notfused in LycoYeast</b>
+
                 <b>Figure 2: </b> <b> Integration of pCONCOMBRE in <i>S.elongatus</i></b>
−
                 <p>pFRAMBOISE-notfused integration from clone D2 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel)</p>
+
                 <p>pCONCOMBRE integration from clone D2 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel)</p>
 
             </div>
 
             </div>
 
         </div>
 
         </div>
Line 56: Line 51:
 
</div>
 
</div>
 
<br>
 
<br>
−
<p>pFRAMBOISE-notfused insert at locus X-3 was successful. The integrant strain was named LycoYeast-pFRAMBOISE-notfused and saved as glycerol stock.</p>
+
<p>pCONCOMBRE insert at locus X-3 was nonetheless successful. The integrant strain was named Synecho-pCONCOMBRE and saved as glycerol stock.</p>
−
<h2>Characterisation</h2>
+
 
−
<h3>Production of &beta;-ionone</h3>
+
−
<p>After verifying the correct integration of our constructs by PCR, our engineered LycoYeast strains were placed on YPD plates containing the inducers with the aim to detect color changes due to the conversion of lycopenes (red) to carotenes (orange).</p>
+
−
<p>Figure 3 shows the colors of the colonies with or without the inducer, the galactose. The LycoYeast-pFRAMBOISE-notfused strain plated on a YPD with doxycycline Petri dish shows a yellow coloration, indicating the degradation of lycopene into &beta;-carotene.</p>
+
−
<br>
+
−
<div class="center">
+
−
        <div class="thumb tnone">
+
−
            <div class="thumbinner" style="width:50%;">
+
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif1.png" class="image">
+
−
                    <img alt="" src="/wiki/images/5/57/T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif1.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif1.png" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 3: </b> <b>Color change in the modified LycoYeast strains</b> 
+
−
                    <p>The mutants seem to change from red (lycopene) to orange (carotene) when plated with the galactose activator, which was the expected result</p>
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<br>
+
−
<p>The carotenoids contained in the cells were extracted using the method described by López et al. (2020). Yeast cells were lysed in acetone using glass beads and the supernatant obtained after this lysis was analyzed by RP-HPLC using a C18 column.In the LycoYeast-pFRAMBOISE-notfused strains, Figure 4 shows that lycopene is converted into a new product with a higher retention time upon induction. Considering the yellow color of pFRAMBOISE-notfused strains, as well as the in-line following &beta;-ionone production results, this new peak most likely corresponds to &beta;-carotene, the expected precursor.
+
−
Nonetheless, it seems that the negative control from the Teto7 promoter doesn't work when there is no inducer added in the media of culture</p>
+
−
<br>
+
−
<div class="center">
+
−
        <div class="thumb tnone">
+
−
            <div class="thumbinner" style="width:50%;">
+
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif2.png" class="image">
+
−
                    <img alt="" src="/wiki/images/d/dc/T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif2.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusPurif2.png" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 4: </b> <b>Carotenoid analysis of the engineered strain LycoYeast-pFRAMBOISE-notfused</b> 
+
−
                    <p>tr= retention time; 3 peaks are observed in a non-modified and a modified but not induced LycoYeast while 4 peaks are present in a LycoYeast-pFRAMBOISE-notfused strain.</p>
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<br>
+
−
<p>The &beta;-ionone is very volatile. A common strategy to avoid losing these molecules during the culture is to grow the engineered microorganisms in a culture medium supplemented with an organic phase to trap the molecules of interest.The most common organic solvent used is dodecane for ionones (Chen et al. 2019; López et al. 2020).Figure 5 shows the GC-MS spectrum for the LycoYeast-FRAMBOISE-notfused strain. A peak can be observed at the same retention time as the &beta;-ionone standard for the induced LycoYeast-FRAMBOISE-notfused strain. The mass spectra associated with this peak matched with the one obtained with the analytical standard. The &beta;-ionone attribution was further confirmed by the NIST mass spectral library (National Institute of Standards and Technology).The production of &beta;-ionone, the main molecule of the violet odour, was successfully achieved with this construction.</p>
+
−
<br>
+
−
<div class="center">
+
−
        <div class="thumb tnone">
+
−
            <div class="thumbinner" style="width:50%;">
+
−
                <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusValidationFluo.png" class="image">
+
−
                    <img alt="" src="/wiki/images/e/e2/T--Toulouse-INSA-UPS--Registry--Youn--CerberusValidationFluo.png" width="100%" height=auto class="thumbimage" /></a>                  <div class="thumbcaption">
+
−
                    <div class="magnify">
+
−
                        <a href="/File:T--Toulouse-INSA-UPS--Registry--Youn--CerberusValidationFluo.png" class="internal" title="Enlarge"></a>
+
−
                    </div>
+
−
                    <b>Figure 5: </b> <b>GC-MS analysis of the dodecane layer of the LycoYeast-pFRAMBOISE-notfused</b>
+
−
                    <p>&beta;-ionone is produced in vivo by our strain LycoYeast-pFRAMBOISE-notfused. On the right are presented the mass spectra that correspond between the standard and the observed peak.</p>
+
−
                </div>
+
−
            </div>
+
−
        </div>
+
−
    </div>
+
−
<br>
+
 
<h2>Conclusion and Perspectives</h2>
 
<h2>Conclusion and Perspectives</h2>
−
<p>These results show that pFRAMBOISE-notfused has the ability to degrade lycopene into &beta;-carotene and futher transform it into the &beta;-ionone. The quantification of &beta;-ionone production remains to be determined under the optimal conditions for the production of the molecule of interest. Moreover a functional Teto7 promoter need to replace the non-functional one.</p>
+
<p>The pCONCOMBRE construction was successfully cloned  into the <i>S.elongatus</i> genome. Nonetheless, The characterisation of the production of the 3,6-nonadienal has not been conducted, future iGEM teams may attempt to produce them to verify the functionality of the construct.</p>
−
<p>The &beta;-ionone belongs to the terpene family and may have other uses besides perfumery, notably in medicine. We sincerely thank the future teams that will use this construction and encourage them to contact us for further details.</p>
+
 
<h2>References</h2>
 
<h2>References</h2>
 
<ol>
 
<ol>
 
     <i>
 
     <i>
−
     <li>Chen X, Shukal S, Zhang C. 2019. Integrating Enzyme and Metabolic Engineering Tools for Enhanced α-Ionone Production. J Agric Food Chem. 67(49):13451–13459. doi:10.1021/acs.jafc.9b00860.</li>
+
     <li>Gale GAR, Osorio AAS, Puzorjov A, Wang B, McCormick AJ. 2019. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. JoVE (Journal of Visualized Experiments).(152):e60451. doi:10.3791/60451.</li>
−
     <li>Jessop-Fabre MM, Jakočiūnas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. 2016. EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 11(8):1110–1117. doi:10.1002/biot.201600147.</li>
+
     <li>Taton A, Unglaub F, Wright NE, Zeng WY, Paz-Yepes J, Brahamsha B, Palenik B, Peterson TC, Haerizadeh F, Golden SS, et al. 2014. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Res. 42(17):e136. doi:10.1093/nar/gku673.</li>
−
    <li>López J, Bustos D, Camilo C, Arenas N, Saa PA, Agosin E. 2020. Engineering Saccharomyces cerevisiae for the Overproduction of β-Ionone and Its Precursor β-Carotene. Front Bioeng Biotechnol. 8:578793. doi:10.3389/fbioe.2020.578793.</li>
+
 
</i>
 
</i>
 
</ol>
 
</ol>

Revision as of 09:41, 10 October 2021


3,6-nonadienal induction system and expression in S. elongatus (pCONCOMBRE) Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 2244
    Illegal EcoRI site found at 2250
    Illegal XbaI site found at 590
    Illegal XbaI site found at 6286
    Illegal XbaI site found at 8003
    Illegal XbaI site found at 8030
    Illegal PstI site found at 8476
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 2244
    Illegal EcoRI site found at 2250
    Illegal NheI site found at 777
    Illegal NheI site found at 872
    Illegal NheI site found at 899
    Illegal PstI site found at 8476
    Illegal NotI site found at 7951
    Illegal NotI site found at 7959
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 2244
    Illegal EcoRI site found at 2250
    Illegal BglII site found at 6283
    Illegal BglII site found at 6289
    Illegal BamHI site found at 3717
    Illegal XhoI site found at 3753
    Illegal XhoI site found at 4736
    Illegal XhoI site found at 6361
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 2244
    Illegal EcoRI site found at 2250
    Illegal XbaI site found at 590
    Illegal XbaI site found at 6286
    Illegal XbaI site found at 8003
    Illegal XbaI site found at 8030
    Illegal PstI site found at 8476
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 2244
    Illegal EcoRI site found at 2250
    Illegal XbaI site found at 590
    Illegal XbaI site found at 6286
    Illegal XbaI site found at 8003
    Illegal XbaI site found at 8030
    Illegal PstI site found at 8476
    Illegal NgoMIV site found at 1936
    Illegal AgeI site found at 2163
    Illegal AgeI site found at 2190
    Illegal AgeI site found at 4955
    Illegal AgeI site found at 7844
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 8686
    Illegal BsaI.rc site found at 911
    Illegal SapI site found at 2653
    Illegal SapI site found at 3728
    Illegal SapI.rc site found at 7355

Introduction

The pCONCOMBRE part (BBa_K3930026) enables the production of 3,6-nonadienal from linolenic and linoleic acids, and is composed by:

- the RA (BBa_K3930027) and LA (BBa_K3930028) integration sites in the NSI locus of the S.elongatus genome (based on the plasmid pAM4951 from Easyclone Marker free kit (Taton et al. 2014))

- the Nb-9-LOX (BBa_K3930030), Cm-9-HPL (BBa_K3930031) and LacI genes (Part:BBa_C0012), for the production of 3,6-nonadienal and LacI repressor. The sequences of the Nb-9-LOX and the Cm-9-HPL were codon optimized for an expression into S.elongatus

- the inducible promoters Trc-theoE-riboswitch (BBa_K3930029) with IPTG and theophylline, driving the expression of Nb-9-LOX and Cm-9-HPL

- the resistance marker SpecR (BBa_K3930032) to select for Cyanobacteria integrants

Construction

IDT performed the DNA synthesis and delivered the part as gBlock. The construct was cloned with an In-Fusion Takara kit into the pAM4951 plasmid and then transformed into E.coli Dh5α strain. Figure 1 shows the restriction map of the resulting clones. The expected restriction profile was obtained for clone A5.

Figure 1: pCONCOMBRE assembly

pCONCOMBRE restriction profile from clone A5 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel)


The plasmid containing the pCONCOMBRE construct was then linearized with the F and R linearization primers pCONCOMBRE. Then the amplicon was integrated into the genome of S.elongatus strain with the traparental conjugation protocol of Gale et al. (2019). Figure 2 shows the electrophoresis gel of PCR on colony to verify clones. The expected sizes were obtained for clone 4, but one amplicon (LA) had not the right size.


Figure 2: Integration of pCONCOMBRE in S.elongatus

pCONCOMBRE integration from clone D2 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel)


pCONCOMBRE insert at locus X-3 was nonetheless successful. The integrant strain was named Synecho-pCONCOMBRE and saved as glycerol stock.

Conclusion and Perspectives

The pCONCOMBRE construction was successfully cloned into the S.elongatus genome. Nonetheless, The characterisation of the production of the 3,6-nonadienal has not been conducted, future iGEM teams may attempt to produce them to verify the functionality of the construct.

References

  1. Gale GAR, Osorio AAS, Puzorjov A, Wang B, McCormick AJ. 2019. Genetic Modification of Cyanobacteria by Conjugation Using the CyanoGate Modular Cloning Toolkit. JoVE (Journal of Visualized Experiments).(152):e60451. doi:10.3791/60451.
  2. Taton A, Unglaub F, Wright NE, Zeng WY, Paz-Yepes J, Brahamsha B, Palenik B, Peterson TC, Haerizadeh F, Golden SS, et al. 2014. Broad-host-range vector system for synthetic biology and biotechnology in cyanobacteria. Nucleic Acids Res. 42(17):e136. doi:10.1093/nar/gku673.
    3.