Difference between revisions of "Part:BBa K3930003"

Revision as of 13:18, 9 October 2021

α-ionone induction system and expression in Saccharomyces cerevisiae (pViolette) Sequence and Features

Introduction

The pVIOLETTE part (BBa_K3930003) enables the production of α-ionone from lycopene and is composed by:

- the up (BBa_K3930021) and down (BBa_K3930022) integration sites in the XII-4 locus of the S.cerevisiae genome (based on the plasmid pCfb3040 from Easyclone Marker free kit (Jessop-Fabre et al.,2016))

- the LcyE-ofCCD1 enzymatic fusion (BBa_K3930024) that allows the production of α-ionone

- the inducible promoters Gal 1 with galactose (BBa_K3930023), driving the expression of LcyE-phCCD1

- the resistance marker NsrR (BBa_K3930025) to select yeast integrants

Construction

IDT and Twist Bioscience performed the DNA synthesis and delivered the part as gBlock. The construct was cloned with an In-Fusion Takara kit into the pCfB3040 plasmid and then transformed into E.coli Dh5α strain. Figure 1 shows the restriction map of the resulting clones. The expected restriction profile was obtained for clone 3.

Figure 1: Figure 1: pViolette assembly: pVIOLETTE restriction profile from clone 3 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel)

The plasmid containing the pVIOLETTE construct was then linearized with the F and R linearization primers pVIOLETTE. Then the amplicon was integrated into the genome of our LycoYeast strain with the Takara Yeast transformation protocol. Figure 2 shows the electrophoresis gel of PCR on colony to verify clones.The expected size was obtained for clone 2.

Primer used to clone this part in the pCfB3040:

• pVIOLETTE_pCfB3040_Forward : 5' cgcccttattcgactctatag 3'
• pVIOLETTE_pCfB3040_Reverse : 5' cgtacctggatggtcatttc 3'

Figure 2: Figure 1: Integration of pVIOLETTE in LycoYeast: pVIOLETTE integration from clone 1 and 2 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel)

pVIOLETTE insert at locus XII-4 was successful. The integrant strain was named LycoYeast-VIOLETTE and saved as glycerol stock.

Characterisation

Production of α-ionone

After verifying the correct integration of our constructs by PCR, our engineered LycoYeast strains were placed on YPD plates containing the inducers with the aim to detect color changes due to the conversion of lycopenes (red) to carotenes (orange).

Figure 3 shows the colors of the colonies with or without the inducer, the galactose. The LycoYeast-VIOLETTE strain plated on a YPGal Petri dish shows a yellow coloration, indicating the degradation of lycopene into ε-carotene.

Figure 3: Color change in the modified LycoYeast strains The mutants seem to change from red (lycopene) to orange (carotene) when plated with the galactose activator, which was the expected result

The carotenoids contained in the cells were extracted using the method described by López et al. (2020). Yeast cells were lysed in acetone using glass beads and the supernatant obtained after this lysis was analyzed by RP-HPLC using a C18 column.In the LycoYeast-VIOLETTE strains, Figure 4 shows that lycopene is converted into a new product with a higher retention time upon induction. Considering the yellow color of pVIOLETTE strains, as well as the in-line following alpha ionone production results, this new peak most likely corresponds to ε-carotene, the expected precursor.

Figure 4: Carotenoid analysis of the engineered strain LycoYeast-pVIOLETTE tr= retention time; 3 peaks are observed in a non-modified and a modified but not induced LycoYeast while 4 peaks are present in a LycoYeast-pVIOLETTE strain.

Anti-His-tag antibodies revealed a band at about 45 kDa in the sample corresponding to IPTG induction in the presence of AzF (lane I+AzF). This band is not present in control samples (lane NI and I-AzF), indicating that it corresponds to the Cerberus protein (theoretical size: 41 kDa). In addition to the full length protein, we observed several extra bands which very likely correspond to proteolysis products since they are detected with the anti-His-tag antibodies. Moreover, the band at 45 kDa is clearly detected in elution samples (lanes E). The purification level of Cerberus with monomeric streptavidin in the elution samples was estimated about 62%. These data show that Cerberus was efficiently purified and can be used for subsequent assays. In addition, these results show that experimental setup to produce Cerberus also leads to the production of a protein where the amber stop codon has not been recognized by the AzF-charged orthogonal tRNA (a construction we named Orthos in our project). Although Orthos does not contain a His-tag at its C-terminus, the protein seems to be efficiently co-purified with Cerberus. The basis of this observation is unclear but this result may suggest that Orthos and Cerberus interact together.

Validation of Cerberus

Validation of the AzF and CBM3a heads using FITC (Fluorescein isothiocyanate) molecules

To validate both the AzF and CBM3a heads of Cerberus, we challenged its potential to functionalize cellulose with fluorescence. To generate a fluorescently labelled Cerberus protein, we first performed a SPAAC reaction on 3.2 µM Cerberus protein using 31.9 µM of FITC-DBCO (Jena Bioscience). In the control experiment, 31.9 µM of FITC alone was used. These samples were then incubated with cellulose for 16 hours and after several washes with resuspension buffer (50mM Tris HCl pH 8), fluorescence levels were measured in the cellulose pellet fractions (Figure 5). We observed that the fluorescence levels in the cellulose pellet incubated with Cerberus protein clicked to FITC were about 3 times higher than in the control experiments corresponding to the cellulose pellet incubated with FITC alone. These results show that Cerberus can efficiently be conjugated with fluorescent molecules bearing a DBCO group by click chemistry and that the resulting fluorescent molecules strongly interact with cellulose.This result proves that cerberus AzF and CBM3a heads are valid and therefore, makes our construction both a practical and potent platform to functionalize cellulose.

Figure 5: Fluorescence remaining in cellulose fraction after several washes Experiment were performed in quadruplicate test in 50 mM Tris HCl pH 8 using 100μL of 10mg/ml Regenerated Amorphous Cellulose and 100μL of click reaction. Samples were incubated for 30 minutes, centrifugated, supernatant discarted and resuspended in Tris HCl four times , *Mann Whitney test p-value 0.03 computed using R 3.4.2.

Validation of the Streptavidin and CBM3a heads

To asses the functionality of the Streptavidin head, we used a non AzF version of Cerberus (its Orthos version). We performed SPAAC reaction to ligate in vitro biotin-DBCO to an azide-functionalized fluorescein (FITC), thus leading to the expected biotinylated FITC. 5.8 μM of Orthos were incubated with 58.0 μM of biotinylated FITC for one hour under shaking and then incubated with regenerated amorphous cellulose as described previously. Fluorescence was measured after four washes and results are presented in figure 6.

Figure 6: Fluorescence remaining in cellulose fraction after several washes Experiment were performed in quadruplicate test in 50 mM Tris HCl pH 8 using 100μL of 10mg/ml Regenerated Amorphous Cellulose and 100μL of binding reaction. Samples were incubated for 30 minutes, centrifugated, supernatant discarted and resuspended in Tris HCl four times , *Mann Whitney test p-value 0.1 computed using R 3.4.2.

The results indicates that fluorescence retained in cellulose pellet is higher when orthos is present which indicates that the binding between biotinylated FITC and Streptavidin was effective, proving that the activity of both streptavidin and CBM3 remains intact when fused. This validated the Streptavidine head.

Validation using paramagnetic beads

The functionality of Cerberus was further characterized using paramagnetic beads. To bind paramagnetic beads to Cerberus, we performed a click reaction using 3.2 µM of Cerberus protein and 32 µM DBCO-conjugated paramagnetic beads. In control experiment, 32 µM of paramagnetic beads were used. These samples were then incubated with cellulose, and after several washes with resuspension buffer, the magnetic capacity of cellulose using a magnet was observed and filmed (See video below). The cellulose incubated with the Cerberus protein conjugated to paramagnetic beads responded quickly and was totally collected by the magnet in contrast to the control experiment. This definitely highlights the potential of Cerberus for many applications