Difference between revisions of "Part:BBa K3970024"

Revision as of 05:10, 7 October 2021

pGAP-CpcA-tADH1

Usage and Biology

CpcA gene encodes α-phycocyanin, a light-harvesting photosynthetic bile pigment-protein from the phycobiliprotein complex (phycobilisome, PBS). Phycocyanin is the major phycobiliprotein in the PBS rod.

Construction

We use primer:XbaI-GAP-up and primer:GAP-cpcA-dn to get the fragment of GAP.

We use primer:cpcA-up and primer:cpcA-ADH1-dn to get the fragment of cpcA.

We use primer:ADH1-up and primer:ADH1-XbaI-dn to get the fragment of ADH1.

Primers we use to construct cpcA expression cassette:<b>

XbaI-GAP-up (48-mer): tcgctccccatttctctagtcattatcaatactgccatttcaaagaat

GAP-cpcA-dn (40-mer): ttcggtgataggggtcttcatggtggcgagatctaattcg

cpcA-up (23-mer): atgaagacccctatcaccgaagc

cpcA-ADH1-dn (41-mer): tcataaatcataagaaattcgctcaggatagagcattgata

ADH1-up (30-mer): gcgaatttcttatgatttatgatttttatt

ADH1-XbaI-dn (33-mer): Cgaactctgcagtcttatatgccggtagaggt

Experiment results

the experimental pictures shows how we recycle the fragment of ADH1 terminator. ( note that how we recycle the GAP promoter and the gene cpcaA has been shown on the last parts.)

Fig. The fragments of the constructed plasmid were recovered

<b>M: Marker

1-4: ADH1(terminator) Sequence and Features