Difference between revisions of "Part:BBa K3970019"

Revision as of 04:49, 5 October 2021

pGAP-CpcE-tCYC1-pGAP-CpcF-tCYC1

Usage and Biology

CpcE and CpcF respectively encode Phycocyanobilin lyase subunit alpha and Phycocyanobilin lyase subunit beta, these two units constitute Phycocyanobilin lyase.Phycocyanobilin lyase is required for the chromophorylation of α-phycocyanin to form holo-α-subunit.

Construction

For yeast is a kind of eukaryote, each gene need one primer and one terminator to construct the expression cassette. For cpcE and cpcF, we use primer GAP and terminator CYC1. We get the gene sequence of cpcE and cpcF from Genscript who helped us synthesized the interest sequence. The GAP promoter is originally on the plasmid pTDH3-dCAS9 and also the terminator is originally on the plasmid p426. We use related primer to cut them down and re-construct them with cpcE and cpcF. The construction procedure is that we separately synthesized expression cassette cpcE and cpcF with primer and terminator. Then we insert the two expression cassette into the plasmid pTDH3（The plsmid has been edited to delete the sequence of dCas9, which will effect the expression of our gene ）

Primers we use to construct cpcE and cpcF expression cassette:

Plasmid skeleton-up (25-mer): gtacccaattcgccctatagtgagt

Plasmid skeleton-dn (21-mer): gctagcccaagagggcacta

cpcF-dn (23-mer): tcaggaggtcaattgggctagtg

cpcE-dn (20-mer): gaccatcaggaggtcaattg

GAP-dn (21-mer): ggcatggtggcgagatctaat

CYC1-dn (23-mer): ggccgcaaattaaagccttcgag

GAP-cpcE-up (43-mer): attagatctcgccaccatgccatgttgtcattagaacaattgg

cpcE-CYC1-up (40-mer): ttggctcaaagatgatggtccgagtcatgtaattagttat

CYC1-GAP-up (44-mer): ctcgaaggctttaatttgcggccggagctcactcggaattcagt

GAP-cpcF-up (41-mer): attagatctcgccaccatgccTattggtgttgacactacca

cpcF-CYC1-up (43-mer): cactagcccaattgacctcctgacgagtcatgtaattagttat

骨架+GAP (42-mer): gtagtgccctcttgggctagcggagctcactcggaattcagt

骨架+CYC1 (43-mer): Ctcgaaggctttaatttgcggccgtacccaattcgccctatag

Experiment results

              
                   Figure1:The fragments of the constructed plasmid were recovered

M:Marker

1-4:CYC1(terminator)

5-8:CpcE

9:GAP (promoter)

10-13:CpcF

14-17:CpcA

Sequence and Features