Difference between revisions of "Part:BBa K3416111"

(→‎Description of rpoC F. psychrophilum capture probe)
 
Line 8: Line 8:
 
Vilnius-Lithuania iGEM 2020 project [https://2020.igem.org/Team:Vilnius-Lithuania <b>FlavoFlow</b>]includes three goals towards looking for <i>Flavobacterium</i> disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines.
 
Vilnius-Lithuania iGEM 2020 project [https://2020.igem.org/Team:Vilnius-Lithuania <b>FlavoFlow</b>]includes three goals towards looking for <i>Flavobacterium</i> disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines.
 
This part was used for the first goal- detection - of the project FlavoFlow.
 
This part was used for the first goal- detection - of the project FlavoFlow.
 +
__TOC__
  
 
==Overview==
 
==Overview==
Line 17: Line 18:
  
 
===Bioinformatic analysis===
 
===Bioinformatic analysis===
−
<i>rpoC</i> gene (JX657167.1) was chosen for F. psychrophilum (ATCC 49418) strain<sup>1</sup>. For the rpoC gene, meant to identify <i>F. psychrophilum</i> we chose 205 - 250 bp region to place detection and capture probes.  
+
<i>rpoC</i> gene (JX657167.1) was chosen for F. psychrophilum (ATCC 49418) strain<ref>Strepparava, N., Wahli, T., Segner, H. & Petrini, O. Detection and quantification of Flavobacterium psychrophilum in water and fish tissue samples by quantitative real time PCR. <i>BMC Microbiology</i>, <b>14</b>, 105 (2014). </ref>. For the rpoC gene, meant to identify <i>F. psychrophilum</i> we chose 205 - 250 bp region to place detection and capture probes.  
  
  
Line 31: Line 32:
  
 
===Description of <i>rpoC</i> <i>F. psychrophilum</i> capture probe===
 
===Description of <i>rpoC</i> <i>F. psychrophilum</i> capture probe===
−
<b>BBa_K3416111</b> is a capture probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticle. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without <b>thiol group</b> modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle<sup>3</sup>. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the <b>5’ end</b>. Also, the probe should contain a <b>poly-A</b> sequence for efficient gold nanoparticles functionalization using a low pH method<sup>4</sup>. The rest of the sequence is left free for hybridization. Thiol group reacts with gold nanoparticle and allows efficient functionalization reaction.
+
<b>BBa_K3416111</b> is a capture probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticle. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without <b>thiol group</b> modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle<ref>Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. <i>Anal. Methods</i>, <b>9</b>, 2633–2643 (2017).</ref>. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the <b>5’ end</b>. Also, the probe should contain a <b>poly-A</b> sequence for efficient gold nanoparticles functionalization using a low pH method<ref>Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. <i>J. Am. Chem. Soc.</i>, <b>134</b>, 7266–7269 (2012).</ref>. The rest of the sequence is left free for hybridization. Thiol group reacts with gold nanoparticle and allows efficient functionalization reaction.
  
  
Line 51: Line 52:
 
[[File:Psyresults.png |thumb|400px|left|<b>Figure 2.</b> <b>1</b> - F. psychrophilum asymmetric HDA with F_Psy and R_Psy primers, 2 - F. psychrophilum symmetric HDA with F_Psy and R_Psy primers after denaturation, 3 - F. psychrophilum asymmetric PCR with F_Psy and R_Psy primers, 4 - F. psychrophilum symmetric PCR with F_Psy and R_Psy primers after denaturation, 5 - F. psychrophilum asymmetric PCR with F_Col and R_Col primers, 6 - F. columnare asymmetric PCR with F_Psy and R_Psy primers, 7 - F. piscis asymmetric PCR with F_Psy and R_Psy primers, 8 - E. coli asymmetric PCR with F_Psy and R_Psy primers, 9 - no DNA template. CL indicates control line, TL - test line.]]
 
[[File:Psyresults.png |thumb|400px|left|<b>Figure 2.</b> <b>1</b> - F. psychrophilum asymmetric HDA with F_Psy and R_Psy primers, 2 - F. psychrophilum symmetric HDA with F_Psy and R_Psy primers after denaturation, 3 - F. psychrophilum asymmetric PCR with F_Psy and R_Psy primers, 4 - F. psychrophilum symmetric PCR with F_Psy and R_Psy primers after denaturation, 5 - F. psychrophilum asymmetric PCR with F_Col and R_Col primers, 6 - F. columnare asymmetric PCR with F_Psy and R_Psy primers, 7 - F. piscis asymmetric PCR with F_Psy and R_Psy primers, 8 - E. coli asymmetric PCR with F_Psy and R_Psy primers, 9 - no DNA template. CL indicates control line, TL - test line.]]
  
 +
<!-- -->
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K3416111 SequenceAndFeatures</partinfo>
 +
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K3416111 parameters</partinfo>
 +
<!-- -->
 
----
 
----
  
−
===References===
+
=References=
−
#  Strepparava, N., Wahli, T., Segner, H. & Petrini, O. Detection and quantification of Flavobacterium psychrophilum in water and fish tissue samples by quantitative real time PCR. <i>BMC Microbiology</i>, <b>14</b>, 105 (2014).
+
<references />
 
#  Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. <i>Journal of Clinical Microbiology</i>, <b>45</b>, 2761–2764 (2007).
 
#  Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. <i>Journal of Clinical Microbiology</i>, <b>45</b>, 2761–2764 (2007).
−
#  Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. <i>Anal. Methods</i>, <b>9</b>, 2633–2643 (2017).
 
−
#  Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. <i>J. Am. Chem. Soc.</i>, <b>134</b>, 7266–7269 (2012).
 

Latest revision as of 23:00, 16 December 2020


F. psychrophilum LFA capture probe (rpoC)

Introduction

FlavoFlow

Vilnius-Lithuania iGEM 2020 project FlavoFlowincludes three goals towards looking for Flavobacterium disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines. This part was used for the first goal- detection - of the project FlavoFlow.

Overview

Vilnius Lithuania iGEM 2020 team decided to create a lateral flow assay (LFA) test for Flavobacterium identification and detection purposes. F. psychrophilum causes bacterial cold water disease in freshwater fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a helicase dependent amplification (HDA)-LFA based detection test that in a few hours can identify an exact bacteria.

Detection system

Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: detection, capture, and control. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is positive, if only one is visible - negative.


Bioinformatic analysis

rpoC gene (JX657167.1) was chosen for F. psychrophilum (ATCC 49418) strain[1]. For the rpoC gene, meant to identify F. psychrophilum we chose 205 - 250 bp region to place detection and capture probes.


To develop the F. psychrophilum LFA test based on rpoC gene these parts are needed: BBa_K3416110, BBa_K3416111,BBa_K3416112. Primers to amplify a fragment of rpoC are:


F_Psy: ACGGGTATTCTTCTTGCTACAAATA

R_Psy: GGATCCCATTTACAAATAACATCTCC


In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in Vilnius-Lithuania iGEM 2020 team wiki page.

Description of rpoC F. psychrophilum capture probe

BBa_K3416111 is a capture probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticle. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without thiol group modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle[2]. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the 5’ end. Also, the probe should contain a poly-A sequence for efficient gold nanoparticles functionalization using a low pH method[3]. The rest of the sequence is left free for hybridization. Thiol group reacts with gold nanoparticle and allows efficient functionalization reaction.


Table 1. | Parameters of capture probe created for nucleic acid lateral flow assay test. Tm and GC% was calculated without poly-A sequence using IDT oligo analyzer tool. (A)20 marks poly-A sequence of 20 adenines. ThioMC6-D - Thiol group modification.
Species Probe type Sequence and its modification Hybridization site Parameters
F. psychrophilum rpoC gene (JX657167.1) Capture probe AAATGACGCTCAAGTTGTAG-(A)20-bio 231 - 250 bp Tm = 50.6°C

GC% = 40%

size = 40 nt

Results

Specificity experiment of F. psychrophilum identification LFA test. Tests were evaluated using 100 nM of DNA in 100 μL of running buffer II (10X SSC, 3.5% Triton X-100, 0.25% SDS, 12.5% formamide).


Figure 2. 1 - F. psychrophilum asymmetric HDA with F_Psy and R_Psy primers, 2 - F. psychrophilum symmetric HDA with F_Psy and R_Psy primers after denaturation, 3 - F. psychrophilum asymmetric PCR with F_Psy and R_Psy primers, 4 - F. psychrophilum symmetric PCR with F_Psy and R_Psy primers after denaturation, 5 - F. psychrophilum asymmetric PCR with F_Col and R_Col primers, 6 - F. columnare asymmetric PCR with F_Psy and R_Psy primers, 7 - F. piscis asymmetric PCR with F_Psy and R_Psy primers, 8 - E. coli asymmetric PCR with F_Psy and R_Psy primers, 9 - no DNA template. CL indicates control line, TL - test line.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


References

  1. ↑ Strepparava, N., Wahli, T., Segner, H. & Petrini, O. Detection and quantification of Flavobacterium psychrophilum in water and fish tissue samples by quantitative real time PCR. BMC Microbiology, 14, 105 (2014).
  2. ↑ Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Anal. Methods, 9, 2633–2643 (2017).
  3. ↑ Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. J. Am. Chem. Soc., 134, 7266–7269 (2012).
  1. Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology, 45, 2761–2764 (2007).