Difference between revisions of "Part:BBa K3416114"

 
Line 3: Line 3:
 
<partinfo>BBa_K3416114 short</partinfo>
 
<partinfo>BBa_K3416114 short</partinfo>
  
−
c ejkhfioer
+
=Introduction=
 +
[[File:T--Vilnius-Lithuania--FFlogo.png|80px|right|FlavoFlow]]
  
−
<!-- Add more about the biology of this part here
+
Vilnius-Lithuania iGEM 2020 project [https://2020.igem.org/Team:Vilnius-Lithuania <b>FlavoFlow</b>]includes three goals towards looking for <i>Flavobacterium</i> disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines.
−
===Usage and Biology===
+
This part was used for the first goal- detection - of the project FlavoFlow.
  
−
<!-- -->
+
==Overview==
−
<span class='h3bb'>Sequence and Features</span>
+
Vilnius Lithuania iGEM 2020 team decided to create a <b>lateral flow assay (LFA)</b> test for <i>Flavobacterium</i> identification and detection purposes. <i>F. columnare</i> causes bacterial cold water disease in freshwater fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a <b>helicase dependent amplification (HDA)-LFA</b> based detection test that in a few hours can identify an exact bacteria.
−
<partinfo>BBa_K3416114 SequenceAndFeatures</partinfo>
+
  
 +
==Detection system==
 +
Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: <b>detection</b>, <b>capture</b>, and <b>control</b>. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is <b>positive</b>, if only one is visible - <b>negative</b>.
  
−
<!-- Uncomment this to enable Functional Parameter display
+
 
−
===Functional Parameters===
+
===Bioinformatic analysis===
−
<partinfo>BBa_K3416114 parameters</partinfo>
+
To improve specificity we found out that <i>cslA</i> gene can be used for F. columnare identification<sup>1</sup>.We created ssDNA probes for hypothetical protein B0A56_04620 (Flavobacterium columnare, NBRC 100251 = ATCC 23463) because we found it to be homologous to cslA protein sequence. These probes were also designed to have a greater GC% and length to improve hybridization reaction.
−
<!-- -->
+
 
 +
 
 +
To develop the <i>F. columnare</i> LFA test based on <i>cslA</i> gene these parts are needed: <b>[https://parts.igem.org/Part:BBa_K3416113  BBa_K3416113,] [https://parts.igem.org/Part:BBa_K3416114 BBa_K3416114,][https://parts.igem.org/Part:BBa_K3416115 BBa_K3416115.]</b> Primers to amplify a fragment of <i>cslA</i> are:
 +
 
 +
<b>F_Colum<sup>1</sup></b>: AATGACTTCAACTAGAACAGTAGGTGCTGA
 +
 
 +
<b>R_Colum</b>: TATGAATTGTGTAATTCACTCCTGCCCCT
 +
 
 +
 
 +
In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in [https://2020.igem.org/Team:Vilnius-Lithuania/Experiments Vilnius-Lithuania iGEM 2020 team wiki page.]
 +
 
 +
===Description of <i>cslA</i> <i>F. columnare</i> detection probe===
 +
<b>BBa_K3416113</b> is a capture probe that is sprayed on the nitrocellulose membrane with a dispensing system such as BioDot. This sequence must be modified. Our team added a <b>poly-A</b> to make sure that the probe sequence itself is available for hybridization. Also  a <b>biotin moiety</b> (bio, IDT) on the <b>3’ end<.b> must be added. Biotin modification is needed so that the probe could be immobilized on the test line of the lateral flow assay test strip via biotin-streptavidin non-covalent interaction.
 +
 
 +
 
 +
 
 +
{| class="wikitable"
 +
|+ style="text-align: left;" | <b>Table 1.</b> | Parameters of capture probe created for nucleic acid lateral flow assay test.
 +
|-
 +
| <b>Species</b> || <b>Probe type</b> || <b>Sequence and its modification</b>
 +
|-
 +
| F. columnare cslA gene (B0A56_04620) || Capture probe || CAGGGAATTATAACTATTATG-(A)20-Bio
 +
|}
 +
 
 +
----
 +
 
 +
===References===
 +
#  Mabrok, M. et al. Development of a species-specific polymerase chain reaction for highly sensitive detection of Flavobacterium columnare targeting chondroitin AC lyase gene. <i>Aquaculture</i>, <b>521</b>, 734597 (2020).
 +
#  Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. <i>Journal of Clinical Microbiology</i>, <b>45</b>, 2761–2764 (2007).
 +
#  Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. <i>Anal. Methods</i>, <b>9</b>, 2633–2643 (2017).
 +
#  Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. <i>J. Am. Chem. Soc.</i>, <b>134</b>, 7266–7269 (2012).

Revision as of 03:41, 28 October 2020


F. columnare LFA capture probe (cslA)

Introduction

FlavoFlow

Vilnius-Lithuania iGEM 2020 project FlavoFlowincludes three goals towards looking for Flavobacterium disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines. This part was used for the first goal- detection - of the project FlavoFlow.

Overview

Vilnius Lithuania iGEM 2020 team decided to create a lateral flow assay (LFA) test for Flavobacterium identification and detection purposes. F. columnare causes bacterial cold water disease in freshwater fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a helicase dependent amplification (HDA)-LFA based detection test that in a few hours can identify an exact bacteria.

Detection system

Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: detection, capture, and control. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is positive, if only one is visible - negative.


Bioinformatic analysis

To improve specificity we found out that cslA gene can be used for F. columnare identification1.We created ssDNA probes for hypothetical protein B0A56_04620 (Flavobacterium columnare, NBRC 100251 = ATCC 23463) because we found it to be homologous to cslA protein sequence. These probes were also designed to have a greater GC% and length to improve hybridization reaction.


To develop the F. columnare LFA test based on cslA gene these parts are needed: BBa_K3416113, BBa_K3416114,BBa_K3416115. Primers to amplify a fragment of cslA are:

F_Colum1: AATGACTTCAACTAGAACAGTAGGTGCTGA

R_Colum: TATGAATTGTGTAATTCACTCCTGCCCCT


In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in Vilnius-Lithuania iGEM 2020 team wiki page.

Description of cslA F. columnare detection probe

BBa_K3416113 is a capture probe that is sprayed on the nitrocellulose membrane with a dispensing system such as BioDot. This sequence must be modified. Our team added a poly-A to make sure that the probe sequence itself is available for hybridization. Also a biotin moiety (bio, IDT) on the 3’ end<.b> must be added. Biotin modification is needed so that the probe could be immobilized on the test line of the lateral flow assay test strip via biotin-streptavidin non-covalent interaction.


<b>Table 1. | Parameters of capture probe created for nucleic acid lateral flow assay test.
Species Probe type Sequence and its modification
F. columnare cslA gene (B0A56_04620) Capture probe CAGGGAATTATAACTATTATG-(A)20-Bio

References

  1. Mabrok, M. et al. Development of a species-specific polymerase chain reaction for highly sensitive detection of Flavobacterium columnare targeting chondroitin AC lyase gene. Aquaculture, 521, 734597 (2020).
  2. Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology, 45, 2761–2764 (2007).
  3. Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Anal. Methods, 9, 2633–2643 (2017).
  4. Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. J. Am. Chem. Soc., 134, 7266–7269 (2012).