Difference between revisions of "Part:BBa K3416110"

(→‎Introduction)
(→‎Bioinformatic analysis)
Line 20: Line 20:
  
  
−
To develop the <i>F. columnare</i> LFA test based on 16S rRNA gene these parts are needed: <b>[https://parts.igem.org/Part:BBa_K3416110  BBa_K3416110,] [https://parts.igem.org/Part:BBa_K3416111 BBa_K3416111,][https://parts.igem.org/Part:BBa_K3416112 BBa_K3416112.]</b> Primers to amplify a fragment of <i>rpoC</i> are:  
+
To develop the <i>F. psychrophilum</i> LFA test based on <i>rpoC</i> gene these parts are needed: <b>[https://parts.igem.org/Part:BBa_K3416110  BBa_K3416110,] [https://parts.igem.org/Part:BBa_K3416111 BBa_K3416111,][https://parts.igem.org/Part:BBa_K3416112 BBa_K3416112.]</b> Primers to amplify a fragment of <i>rpoC</i> are:  
  
  
Line 29: Line 29:
  
 
In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in [https://2020.igem.org/Team:Vilnius-Lithuania/Experiments Vilnius-Lithuania iGEM 2020 team wiki page.]
 
In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in [https://2020.igem.org/Team:Vilnius-Lithuania/Experiments Vilnius-Lithuania iGEM 2020 team wiki page.]
−
 
  
 
===Description of <i>rpoC</i> <i>F. psychrophilum</i> detection probe===
 
===Description of <i>rpoC</i> <i>F. psychrophilum</i> detection probe===

Revision as of 02:54, 28 October 2020


F. psychrophilum LFA detection probe (rpoC)

Introduction

FlavoFlow

Vilnius-Lithuania iGEM 2020 project FlavoFlowincludes three goals towards looking for Flavobacterium disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines. This part was used for the first goal- detection - of the project FlavoFlow.

Overview

Vilnius Lithuania iGEM 2020 team decided to create a lateral flow assay (LFA) test for Flavobacterium identification and detection purposes. F. psychrophilum causes bacterial cold water disease in freshwater fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a helicase dependent amplification (HDA)-LFA based detection test that in a few hours can identify an exact bacteria.

Detection system

Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: detection, capture, and control. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is positive, if only one is visible - negative.


Bioinformatic analysis

rpoC gene (JX657167.1) was chosen for F. psychrophilum (ATCC 49418) strain1. For the rpoC gene, meant to identify F. psychrophilum we chose 205 - 250 bp region to place detection and capture probes.


To develop the F. psychrophilum LFA test based on rpoC gene these parts are needed: BBa_K3416110, BBa_K3416111,BBa_K3416112. Primers to amplify a fragment of rpoC are:


F_Psy: ACGGGTATTCTTCTTGCTACAAATA

R_Psy: GGATCCCATTTACAAATAACATCTCC


In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in Vilnius-Lithuania iGEM 2020 team wiki page.

Description of rpoC F. psychrophilum detection probe

BBa_K3416110 is a detection probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticle. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without thiol group modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle3. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the 5’ end. Also, the probe should contain a poly-A sequence for efficient gold nanoparticles functionalization using a low pH method4. The rest of the sequence is left free for hybridization. Thiol group reacts with gold nanoparticle and allows efficient functionalization reaction.


Table 1. | Parameters of detection probe created for nucleic acid lateral flow assay test. Tm and GC% was calculated without poly-A sequence using IDT oligo analyzer tool. (A)20 marks poly-A sequence of 20 adenines. ThioMC6-D - Thiol group modification.
Species Probe type Sequence and its modification Hybridization site Parameters
F. psychrophilum rpoC gene (JX657167.1) Detection probe ThioMC6-D-(A)20-ATTCCTTACGGTTCAAGTAT 205 - 224 bp Tm = 48.5°C

GC% = 35%

size = 40 nt

Results

Specificity experiment of F. psychrophilum identification LFA test. Tests were evaluated using 100 nM of DNA in 100 μL of running buffer II (10X SSC, 3.5% Triton X-100, 0.25% SDS, 12.5% formamide).


Figure 2. 1 - F. psychrophilum asymmetric HDA with F_Psy and R_Psy primers, 2 - F. psychrophilum symmetric HDA with F_Psy and R_Psy primers after denaturation, 3 - F. psychrophilum asymmetric PCR with F_Psy and R_Psy primers, 4 - F. psychrophilum symmetric PCR with F_Psy and R_Psy primers after denaturation, 5 - F. psychrophilum asymmetric PCR with F_Col and R_Col primers, 6 - F. columnare asymmetric PCR with F_Psy and R_Psy primers, 7 - F. piscis asymmetric PCR with F_Psy and R_Psy primers, 8 - E. coli asymmetric PCR with F_Psy and R_Psy primers, 9 - no DNA template. CL indicates control line, TL - test line.

References

  1. Declercq, A. M., Haesebrouck, F., Van den Broeck, W., Bossier, P. & Decostere, A. Columnaris disease in fish: a review with emphasis on bacterium-host interactions. Vet Res, 44, 27 (2013).
  2. Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology, 45, 2761–2764 (2007).
  3. Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Anal. Methods, 9, 2633–2643 (2017).
  4. Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. J. Am. Chem. Soc., 134, 7266–7269 (2012).