Difference between revisions of "Part:BBa K3520009"
Line 17: Line 17:
 
The interesting fact about this plasmid is that the KanR gene is expressed in most <i>E. coli</i> strains, whereas ErmF is not\cite{somethirdthing}. In stark contrast, the ErmF gene is expressed in other bacteria, such as Flavobacteriia, making pHimarEm1 a prime candidate for conjugation based genetic transfer, especially for bacteria where transformation is not as efficient as conjugation. The precise reason that ErmF is not expressed in most <i>E. coli</i> is not known, to our knowledge.  
 
The interesting fact about this plasmid is that the KanR gene is expressed in most <i>E. coli</i> strains, whereas ErmF is not\cite{somethirdthing}. In stark contrast, the ErmF gene is expressed in other bacteria, such as Flavobacteriia, making pHimarEm1 a prime candidate for conjugation based genetic transfer, especially for bacteria where transformation is not as efficient as conjugation. The precise reason that ErmF is not expressed in most <i>E. coli</i> is not known, to our knowledge.  
 
<br/><br/>
 
<br/><br/>
−
Furthermore, the plasmid carries the Mariner transposase\cite{somemorestuff} and the corresponding inverted repeats (IRs), which are: GGGGGGGGGGGGGGGG and CCCCCCCCCCCCCCCCCC.
+
Furthermore, the plasmid carries the Mariner transposase\cite{somemorestuff} and the corresponding inverted repeats (IRs), which are: ACAGGTTGGCTGATAAGTCCCCGGTC and AGACCGGGGACTTATCAGCCAACCTG.
 
<br/><br/>
 
<br/><br/>
 
In order to make transposition inducible, the transposase is placed under the control of an inducible lac promoter using the regular lac operon\cite{somefifthstuff}. This means that transposition can be initiated at will by introducing IPTG to the growth medium.
 
In order to make transposition inducible, the transposase is placed under the control of an inducible lac promoter using the regular lac operon\cite{somefifthstuff}. This means that transposition can be initiated at will by introducing IPTG to the growth medium.
Line 27: Line 27:
 
<br>
 
<br>
  
−
BcsD seems to be required for the arrangement of the BCS complex along the longitudinal cell axis. Although most biofilm-forming bacteria likely produce amorphous cellulose that is embedded in a 3D matrix of polysaccharides, proteinaceous fibers, and nucleic acids, some bacteria produce cellulose microfibrils resembling those synthesized by eukaryotic cells. In such bacteria, CesA complexes are linearly arranged along the cell axis, and the CesA operons encode at least one additional subunit, BcsD, that might facilitate the linear organization of the synthases.
+
Proteins encoded by pHimar were optimized for expression in Flavobacteriia, utilizing the Kazusa codon database\cite{kazusa}.
 +
<br><br>
 +
Furthermore, the plasmid was checked for the existence of other ORFs that may be translated and would place unnecessary metabolic burden on our strain. After a thorough search, where each putative ORF was searched against the Pfam, TIGRFAM  Gene3D, Superfamily, PIRSF, TreeFam, the only putative ORF that matched any known motif was the remainder of another transposase, as revealed by BLAST.
 +
Furthermore, for each ORF, the 100 immediate bases upstream of the start codon were queried for the existence of promoter sequences using 5 bacterial promoter sequence prediction services: CNNProm iPro50FMIWin 70ProPred iPromoter-2L.
 
<br><br>
 
<br><br>
  
−
 
+
<br><br>
 
=Athens 2020=
 
=Athens 2020=
 
<br>
 
<br>
Line 42: Line 45:
 
<br>
 
<br>
  
−
The nucleotide sequences of the pHimarEm1 plasmid was obtained upon communication with Dr. Mark J. McBridge, as well as Dr. Colin Ingham. Published maps of the plasmid exist, but this is the first time the complete sequence is deposited to our knowledge
+
The nucleotide sequences of the pHimarEm1 plasmid was obtained upon communication with Dr. Mark J. McBridge, as well as Dr. Colin Ingham. Published maps of the plasmid exist, but this is the first time the complete sequence is deposited to our knowledge.
 
<br><br>
 
<br><br>
  

Revision as of 01:29, 28 October 2020


pHimarEm1


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 6663
    Illegal NheI site found at 330
    Illegal SpeI site found at 2
    Illegal PstI site found at 16
    Illegal NotI site found at 9
    Illegal NotI site found at 6669
  • 21
    INCOMPATIBLE WITH RFC[21]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 6663
    Illegal BglII site found at 652
    Illegal BglII site found at 3191
    Illegal BglII site found at 3850
    Illegal XhoI site found at 287
    Illegal XhoI site found at 3488
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal prefix found at 6663
    Illegal suffix found at 2
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal prefix found at 6663
    Plasmid lacks a suffix.
    Illegal XbaI site found at 6678
    Illegal SpeI site found at 2
    Illegal PstI site found at 16
    Illegal NgoMIV site found at 1316
    Illegal AgeI site found at 2883
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.



This is the sequence for the backbone of one of the main plasmids that is used in order to genetically manipulate several categories of bacteria, including Flavobacteriia\cite{mcbride1996}.



Description


This rather big plasmid has long been used in order to integrate genetic material into the genome of Flavobacteria\cite{someotherthing}. While it is 6 kb long, not all of them are functional. The main points of interest of this plasmid are its gene encoding a protein that confers resistance to Kanamycin and Neomycin (KanR from Tn4351), Aminoglycosidase phosphotransferase and the gene encoding a protein that confers resistance to Erythromycin (ErmF from Bacteroides fragilis), rRNA adenine N-6-methyltransferase.

The interesting fact about this plasmid is that the KanR gene is expressed in most E. coli strains, whereas ErmF is not\cite{somethirdthing}. In stark contrast, the ErmF gene is expressed in other bacteria, such as Flavobacteriia, making pHimarEm1 a prime candidate for conjugation based genetic transfer, especially for bacteria where transformation is not as efficient as conjugation. The precise reason that ErmF is not expressed in most E. coli is not known, to our knowledge.

Furthermore, the plasmid carries the Mariner transposase\cite{somemorestuff} and the corresponding inverted repeats (IRs), which are: ACAGGTTGGCTGATAAGTCCCCGGTC and AGACCGGGGACTTATCAGCCAACCTG.

In order to make transposition inducible, the transposase is placed under the control of an inducible lac promoter using the regular lac operon\cite{somefifthstuff}. This means that transposition can be initiated at will by introducing IPTG to the growth medium.

Finally, the R6K γ ori ensures that the plasmid can be stably replicated when not integrated in the bacterial chromosome.

Optimization & Protein Analysis


Proteins encoded by pHimar were optimized for expression in Flavobacteriia, utilizing the Kazusa codon database\cite{kazusa}.

Furthermore, the plasmid was checked for the existence of other ORFs that may be translated and would place unnecessary metabolic burden on our strain. After a thorough search, where each putative ORF was searched against the Pfam, TIGRFAM Gene3D, Superfamily, PIRSF, TreeFam, the only putative ORF that matched any known motif was the remainder of another transposase, as revealed by BLAST. Furthermore, for each ORF, the 100 immediate bases upstream of the start codon were queried for the existence of promoter sequences using 5 bacterial promoter sequence prediction services: CNNProm iPro50FMIWin 70ProPred iPromoter-2L.



Athens 2020


The current part is utilised by the iGEM Athens 2020 team during the project MORPHÆ. In this project, Flavobacteria were used to produce a non-cellular structurally coloured biomaterial which would require the secretion of a biomolecule that Flavobacteria do not normally secrete. Our hypothesis is that the formed matrix will have a structure similar to that of the biofilm and thus, it will provide the material with macroscopically the same colouration properties as the biofilm.

In order to transfer the desired genes into the genome of Flavobacterium johnsoniae, our chassis of choice, we utilise conjugation of the strain UW101 with E. coli S17-1. Once conjugation is complete, transposition will be induced, in order to integrate the genes of interest into F. johnsoniae's chromosome, after which expression will occur.


SOURCE OF THIS PART


The nucleotide sequences of the pHimarEm1 plasmid was obtained upon communication with Dr. Mark J. McBridge, as well as Dr. Colin Ingham. Published maps of the plasmid exist, but this is the first time the complete sequence is deposited to our knowledge.

Useful Links:


NCBI taxonomy:

https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=28448&lvl=3&lin=f&keep=1&srchmode=1&unlock

GenBank link:

https://www.ncbi.nlm.nih.gov/nuccore/X54676.1

Codon optimisation bank:

http://genomes.urv.es/OPTIMIZER/?fbclid=IwAR0ALbP_C8UVY4itvYdNX8b5KYYUM5ulQojz8UJAK6Zj5llobNNxE-jYmXQ

Codon optimization table:

https://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=376686&fbclid=IwAR0gwwrIarZsiYhWvHPc2BKy-iB_2OM-DPB5I2HYJZwBNiasmlLXWK87PwM



REFERENCES


Braun, T., Khubbar, M., Saffarini, D., & McBride, M. (2005). Flavobacterium johnsoniae Gliding Motility Genes Identified by mariner Mutagenesis. Journal Of Bacteriology, 187(20), 6943-6952. doi: 10.1128/jb.187.20.6943-6952.2005

Buldum, G., Bismarck, A., & Mantalaris, A. (2017). Recombinant biosynthesis of bacterial cellulose in genetically modified Escherichia coli. Bioprocess And Biosystems Engineering, 41(2), 265-279. doi: 10.1007/s00449-017-1864-1

Johansen, V., Catón, L., Hamidjaja, R., Oosterink, E., Wilts, B., & Rasmussen, T. et al. (2018). Genetic manipulation of structural color in bacterial colonies. Proceedings Of The National Academy Of Sciences, 115(11), 2652-2657. doi: 10.1073/pnas.1716214115

McBride, M., & Kempf, M. (1996). Development of techniques for the genetic manipulation of the gliding bacterium Cytophaga johnsonae. Journal Of Bacteriology, 178(3), 583-590. doi: 10.1128/jb.178.3.583-590.1996

Nakamura, Y. (2000). Codon usage tabulated from international DNA sequence databases: status for the year 2000. Nucleic Acids Research, 28(1), 292-292. doi: 10.1093/nar/28.1.292

Omadjela, O., Narahari, A., Strumillo, J., Melida, H., Mazur, O., Bulone, V., & Zimmer, J. (2013). BcsA and BcsB form the catalytically active core of bacterial cellulose synthase sufficient for in vitro cellulose synthesis. Proceedings Of The National Academy Of Sciences, 110(44), 17856-17861. doi: 10.1073/pnas.1314063110

Römling, U., & Galperin, M. (2015). Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions. Trends In Microbiology, 23(9), 545-557. doi: 10.1016/j.tim.2015.05.005