Difference between revisions of "Part:BBa K1139201"

Line 59: Line 59:
 
The results from the Department of Biology at the College of William and Mary show greater absolute sfGFP fluorescence was observed in the promoter construct insulated with the RiboJ sequence, as compared to the promoter without RiboJ insulation (Clifton 4). It was determined from this experiment that using a RiboJ insulator within the composite part construct leads to increased sfGFP protein expression and higher concentration of mRNA transcripts (Clifton 4).
 
The results from the Department of Biology at the College of William and Mary show greater absolute sfGFP fluorescence was observed in the promoter construct insulated with the RiboJ sequence, as compared to the promoter without RiboJ insulation (Clifton 4). It was determined from this experiment that using a RiboJ insulator within the composite part construct leads to increased sfGFP protein expression and higher concentration of mRNA transcripts (Clifton 4).
 
</p>
 
</p>
[[Image:https://static.igem.org/mediawiki/parts/8/89/T--UFlorida--_Cole11.jpeg]]
+
 
 +
[[Image:parts.igem.org/wiki/images/8/89/T--UFlorida--_Cole11.jpeg|thumb|none|300px|]]
 +
 
 +
 
 +
 
  
 
<p>
 
<p>

Revision as of 23:15, 27 October 2020

PphoA-GFP-TT

PphoA is a promoter that is activated by PhoB-phosphorylated when phosphate concentration is low. GFP is a reporter.

We improved a phosphate sensor part since the existing phosphate sensor part (OUC-China 2012, BBa_K737024) did not have sufficient data.

We constructed this improved part (Fig. 1) by amplifying the phoA promoter region of E. coli (MG1655) and ligating this phoA promoter (BBa_K1139200) upstream of the promoterless GFP generator (BBa_I751310). This phoA promoter is the inducible promoter of the alkaline phosphatase gene (phoA) derived from E. coli (Dollard et al., 2003). This promoter is repressed by high phosphate concentrations (Shinagawa et al., 1983; Hsieh et al., 2010) (Fig. 2).


Fig. 1. Our improved part: BBa_K1139201
Fig. 2. Regulation of the phoA promoter

By an induction assay, this part was confirmed to be repressed by the increase in phosphate concentration.

Compared to OUC-China’s phosphate sensor part including the phoB promoter (Fig. 4), our phosphate sensor part showed a clearer result (Fig. 3) (Note that the scales of the vertical axis are different between the two results).



From our results above, we determined parameters for the induction mechanism by fitting the results to the following Hill equation (Fig. 5). α denotes the maximum GFP expression rate in this construct. m denotes the phosphate concentration at which the GFP expression rate is half of α. β denotes the hill coefficient. Those parameters (Tab. 1) can be used in future modeling.

Plants are reported to be in phosphate starvation when its concentration is below 1 mM (Hoagland et al., 1950). Our part can sense the concentration below 1 mM, too (Fig. 6). Therefore, we believe our improved part can be applied to agricultural field. For instance, we have a future plan to create E. coli that could increase plant growth by synthesizing several plant hormones depending on the soil environment.

Fig. 5. Equation for the induction mechanism
Parameter Value
        α 1700
        β 5.8
        m 160

Tab. 1. Determined parameters
α denotes the maximum GFP expression rate in this construct.
m denotes the phosphate concentration at which the GFP expression rate is half of α.
β denotes the hill coefficient.


The result of our model is shown in Fig. 6.

Fig. 6. A model with fitting the results of our assay

For more information, see [http://2013.igem.org/Team:Tokyo_Tech/Experiment/phoA_Promoter_Assay our work in Tokyo_Tech 2013 wiki].

Team UFlorida's Contribution (2020)

In the absence of a lab, The University of Florida 2020 iGEM team offers literature to further understand and improve part BBa_K1139201. To increase the expression of part BBa_K1139201 designed by iGem Tokyo 2013 Team, and sfGFP proteins of future iGEM projects, the RiboJ insulator sequence can be added between the pPhoA promoter and the downstream sequences. Insulators protect against unexpected interactions between neighboring sequences in a genetic circuit (Clifton 2). A common insulator, RiboJ, is made up of the sTRSV-ribozyme, along with a subsequent 23-nucleotide hairpin sequence (Luo 3). The hairpin structure helps expose the ribosome binding site, so that translation can be increased for the downstream sequence transcripts (Luo 3). Therefore, insulators, and specifically, the RiboJ sequence, can be used to increase the efficacy of gene and protein expression in future experimental genetic constructs. the part would look like this.

The results from the Department of Biology at the College of William and Mary show greater absolute sfGFP fluorescence was observed in the promoter construct insulated with the RiboJ sequence, as compared to the promoter without RiboJ insulation (Clifton 4). It was determined from this experiment that using a RiboJ insulator within the composite part construct leads to increased sfGFP protein expression and higher concentration of mRNA transcripts (Clifton 4).



RiboJ insulator DNA sequence (Meyer 4): AGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGCCTCTACAAATAATTTTGTTTAA

By including the DNA sequence (listed above) between the pPhoA and the subsequent genes in Part BBa_K1139201, the expression of sfGFP protein will be increased in future experiments that quantify absolute fluorescence as the output of an experimental design.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 754