Difference between revisions of "Part:BBa K3558000:Design"
Line 17: Line 17:
 
Constructs were designed to be inserted into the pET-19b plasmid backbone, a standard protein expression vector. It possesses the ampicillin resistance gene to allow for selection of successfully transformed colonies. It also utilises the T7 expression system, which compliments our chosen chassis E.coli BL21 DE3. The DE3 strains carry a copy of the phage T7 RNA polymerase gene which is controlled by a lac promoter. When isopropyl β- d-1-thiogalactopyranoside (IPTG)  is added, the T7 RNA Polymerase is expressed and can bind to the plasmid T7 promoter and begin the transcription of the inserted gene.  
 
Constructs were designed to be inserted into the pET-19b plasmid backbone, a standard protein expression vector. It possesses the ampicillin resistance gene to allow for selection of successfully transformed colonies. It also utilises the T7 expression system, which compliments our chosen chassis E.coli BL21 DE3. The DE3 strains carry a copy of the phage T7 RNA polymerase gene which is controlled by a lac promoter. When isopropyl β- d-1-thiogalactopyranoside (IPTG)  is added, the T7 RNA Polymerase is expressed and can bind to the plasmid T7 promoter and begin the transcription of the inserted gene.  
  
−
[[File:T--iGEM20 UNSW Australia--plasmid.png|500px|thumb|center|pET-19b Plasmid (5717 bp)]]
+
 
 +
 
 +
[[File:T--iGEM20 UNSW Australia--u1.png|500px|thumb|center| Figure 2: Diagram of pET-10b plasmid with the insert HSP22E. A similar plasmid was designed for the HSP22F insert. Ampicillin resistance gene (AmpR) and Lac repressor (LacI) can be seen alongside their respective promoters. Gene was inserted with designed overhangs in between T7 promoter and terminator. Image produced on Benchling.]]
  
  

Revision as of 13:55, 27 October 2020


Small Heat Shock Protein 22E (sHSP22E)


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 455
    Illegal PstI site found at 461
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 455
    Illegal PstI site found at 461
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 455
    Illegal PstI site found at 461
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 455
    Illegal PstI site found at 461
  • 1000
    COMPATIBLE WITH RFC[1000]

Plasmid Design with HSP22E and HSP22F Inserts

DNA sequences for our genes of interest (HSP22E and HSP22F) were obtained from Genbank. Gene constructs for each were designed with the following features: Gibson forward and reverse overhangs - These were added onto both 5’ and 3’ ends of the gene sequences. The overhangs were complementary to the pET-19b plasmid backbone. Fwd: 5’ CGGCTGCTAACAAAGCCCGA 3’ Rev: 5’ CTTTAAGAAGGAGATATACC 3’ 6x His-tag and GSG linker - The His-tag consisted of six histidines, which later allowed for protein purification using an affinity column. The GSG linker allowed for protein folding without interference by the 6xHis-tag. 5’ GGCTCCGGCGGACATCATCATCATCACCATTAA 3’ As the HSP22 genes were obtained from eukaryotic C. reinhardtii, gene constructs were codon optimised for E. coli using the IDT Codon Optimisation Tool. DNA g-blocks were synthesised from Integrated DNA Technologies (IDT).

Constructs were designed to be inserted into the pET-19b plasmid backbone, a standard protein expression vector. It possesses the ampicillin resistance gene to allow for selection of successfully transformed colonies. It also utilises the T7 expression system, which compliments our chosen chassis E.coli BL21 DE3. The DE3 strains carry a copy of the phage T7 RNA polymerase gene which is controlled by a lac promoter. When isopropyl β- d-1-thiogalactopyranoside (IPTG) is added, the T7 RNA Polymerase is expressed and can bind to the plasmid T7 promoter and begin the transcription of the inserted gene.


Figure 2: Diagram of pET-10b plasmid with the insert HSP22E. A similar plasmid was designed for the HSP22F insert. Ampicillin resistance gene (AmpR) and Lac repressor (LacI) can be seen alongside their respective promoters. Gene was inserted with designed overhangs in between T7 promoter and terminator. Image produced on Benchling.



Design Notes

The sHSP22E codons were optimised via IDT's Codon Optimization Tool. His-tags were also added to the C-terminal of the sHSP22E sequence for purification purposes in the later stages of the the experiment.


Source

The sHSP22E sequence was retrieved from GenBank (1).

References

1. Chlamydomonas reinhardtii strain CC-503 cw92 mt+ CHLREscaffold_1 genom - Nucleotide - NCBI [Internet]. Ncbi.nlm.nih.gov. 2020 [cited 22 October 2020]. Available from: https://www.ncbi.nlm.nih.gov/nuccore/NW_001843471.1?from=5781321&to=5782811&report=genbank