Difference between revisions of "Part:BBa K3570006"
Line 13: Line 13:
  
 
<p> <strong>A. Protocols </strong></p><br>
 
<p> <strong>A. Protocols </strong></p><br>
−
<strong>1. Preparation of yeast competent cells</strong><br>
 
−
<strong>- Materials</strong><br>
 
−
75 mL of YPD medium.<br>
 
−
50mL falcon-tube.<br>
 
−
Centrifuge<br>
 
−
26mL of LiAc/TE.<br>
 
−
<strong>- Methods</strong>
 
−
<li>Overnight preculture from a fresh colony of yeast in 25mL of YPD.</li>
 
−
<li>Dilute overnight precultures to low OD600 (e.g. 0.05) in 50 ml fresh YPD medium.</li>
 
−
<li>Mesure concentration every 2h to 3h until it reaches an OD of around 0.8.</li>
 
−
<li>Transfer 50mL to a 50mL falcon-tube and centrifuge 5min at 3000rpm (room-temperature).</li>
 
−
<li>Remove flow-thru and add 25mL of LiAc/TE, mix thoroughly by inverting the tube 10 times.</li>
 
−
<li>Centrifuge 5min at 3000rpm (at room-temperature).</li>
 
−
<li>Remove flow-thru.</li>
 
−
<li>Add 400uL of LiAc/TE, mix thoroughly by inverting the tube 10 times.<br>
 
−
Yeast competent cells should be used on the same day that they have been prepared.</li>
 
  
−
<p><strong>2. Yeast transformation</strong></p>
+
<li><strong>Preparation of yeast competent cells</strong></li><br>
−
<p><strong>-Materials</strong></p>
+
<p>Fresh yeast were grown in 25ml of YPD medium overnight. This preculture was diluted to low OD600nm (e.g. 0.05) in 50ml of fresh YPD medium. The biomass concentration was measured every two hours until it reaches an OD600nm of around 0.8. The 50ml of culture was transfered in a 50ml falcon-tube and was centrifuged 5 minutes at 3000rpm at room temperature. The supernatant was removed and 25ml of LiAc/TE was added. The tube had to be thoroughly inverting 10 times. The tube was centrifuged 5 minutes at 3000rpm at room temperature. The supernatante was removed and 400µl of LiAc/TE was added. The tube had to be thoroughly inverting 10 times. Yeast competent cells should be used on the same day that they have been prepared.</p><br>
−
<p>Transforming DNA
+
−
Competent yeast cells
+
−
10mg/ml carrier DNA (SS-DNA)
+
−
50% PEG in 100mM LiAc/TE
+
−
NaCl
+
−
YNB plates (with all the amino acids except histidine)
+
−
30ºC warm bath
+
−
42ºC warm bath
+
−
30ºC incubator
+
−
table-top microcentrifuge
+
−
1.5mL microcentrifuge tube</p>
+
−
<p><strong>-Method</strong></p>
+
  
−
<li>Prepare mix in 1.5mL microcentrifuge tube:</li>
+
<li><strong>Yeast transformation</strong></li><br>
 +
<p>A mix in 1.5ml microcentrifuge tube was prepared with 2µl of transforming DNA (BBa_K3570000), 40µl of competente yeast cells , 25µg of carrier DNA (SS-DNA) and 168µl of 50% PEG in 100mM LiAc/TE.<br>
 +
Positive control was the same mixture but the transforming DNA was replaced by 1uL of pR313. The negative control was the same mixture but had no transforming DNA.
 +
After vortexing, the solution was incubated 45 minutes at 30°C. Then 13µl of DMS0 was added and the solution was vortexed again. It was centrifuged at 10,000 rpm for 1 minute. The supernatante was removed and the pellet was resuspended in 80µl of NaCl. The solution was seeded on petri dishe of YNB with all amino acids expect histidine. Our selectable marker was histidine. The petri dishe was incubated at 30°C for three days.</p><br>
  
−
[[File:T--Toulouse_INSA-UPS--2020_CB-F8.png|500px|thumb|center]]
+
<li><strong>Integration verification PCR</strong></li><br>
 +
<p>The integration of BBa_K3570000 using the DPP1 homoly sequence (BBa_K3570006 and BBa_K3570007) was performed by a genomic PCR using the TaKaRa PCR amplification Kit. Our insert was to big to be amplified by PCR. We therefore decided to amplified a part of 1200kb in the genome. The following primers have been used. The primer 1 (forward hybridizes on our selectable marker HIS3 . The primer 2 (reverse) hybridizes on the 1,039,876 pb of the chromosome IV of the strain BY4741 (upstream of the DPP1 gene).</p><br>
  
−
<p>Positive control was performed by adding 1uL of pR313 instead of the transforming DNA, and negative control had no DNA.</p>
+
<strong>B. Results and discussion</strong><br>
−
<ol>
+
−
<li>Vortex solution.</li>
+
−
<li>Incubate 45min at 30ºC.</li>
+
−
<li>Add 13uL of DMS0 and vortex solution.</li>
+
−
<li>Incubate 15min at 42ºC.</li>
+
−
<li>Add 450uL of NaCl and vortex solution.</li>
+
−
<li>Centrifuge at 10000rpm for 1min.</li>
+
−
<li>Remove flowthru and resuspend pellet with 80uL of NaCl.</li>
+
−
<li>Plate solution on YNB plates (with all the amino acids except for the ….)</li>
+
−
<li>Incubate at 30ºC for two to three days.</li>
+
  
 +
<p>Since the construction of the part BBa_K3570000 was successful, we proceeded to the next step: integration in the yeast genome. The plasmid was digested with enzymes SbfI and EcoRI and purified to transform the yeast Saccharomyces cerevisiae resulting in th strain BY4741 DPP::tHMG1-crtE. The yeast was then grown on YNB with all amino acids expect histidine for 3 days. At the third try, we were able to observe around 20 colonies in our yeast transformation, about the same on the positive control and none on the negative control plate. We randomly chose eight clones from our transformation and one from the positive control plate (see on the figure 1 below) for PCR verification integration.</p>
  
 +
[[File:T--Toulouse_INSA-UPS--2020_CB-F7.png|500px|thumb|center|Figure1: Verification of the integration of the part BBa_K3570000 in the yeast genome using DPP1 homology sequence (BBa_3570006 and BBa_3570007). The expected size is 1.2kb.]]
  
−
<p><strong>B. Results and discussion:</strong></p><br>
+
<p>All clones have the expected size (1.2kb), and the control where we inserted pRS313 does not show any band.<br>
 +
The integration of BBa_K3570000 should results in an increase of the GGPP quantity. For further verification, we analyzed the quantity of GGPP in the strain BY4741 DPP::tHMG1-crtE and in the wild type.</p><br>
  
−
<p>Since the construction of the part BBa_K3570000 was successful, we proceeded to the next step: integration in the yeast genome. The plasmid was digested with enzymes <em>Sbf</em>I and <em>EcoR</em>I and purified to transform the yeast Saccharomyces cerevisiae. The yeast was then grown on YNB HIS- for 3 days. At the third try, we were able to observe around 20 colonies in our yeast transformation, about the same on the positive control and none on the negative control plate.</p>
+
[[File:T--Toulouse_INSA-UPS--2020_CB-F7.png|500px|thumb|center|Figure 2: Results of the GGPP analysis from culture on YNB with 2% Glucose by LC-MS]]
−
<p>To verify our colonies we performed a genomic PCR using the TaKaRa PCR Amplification Kit using the following primers.We randomly chose eight clones from our transformation and one from the positive control plate (Figure 7).</p>
+
−
<p> Primer 1: ATCAGGATTTGCGCCTTT</p>
+
−
<p>Primer 2: AAGCAGGCCCTTGCACGTCAAG</p>
+
  
−
 
+
<p>According to the figure 2, our strain BY4741 DPP::tHMG1-crtE showed a five-fold increase in GGPP concentration in comparison with the wild type yeast.
−
[[File:T--Toulouse_INSA-UPS--2020_CB-F7.png|500px|thumb|center|Figure: Verification of the integration of the part BBa_K3570000 in the yeast genome using DPP1 homology sequence (BBa_3570006 and BBa_3570007). The expected size is 1.2kb.]]
+
These two verifications proved that we have successfully integrated tHmg1 and CrtE into the yeast using DPP1 homology sequence!</p>
−
 
+
−
<p>All clones have the expected size (1.2kb), and the control where we inserted pRS313 does not show any band. We have successfully integrated tHmg1 and CrtE into the yeast using DPP1 homology sequence!</p>
+
  
 
<h2>References</h2>
 
<h2>References</h2>

Revision as of 10:27, 26 October 2020


DPP1 upstream homologous sequence

Usage

DPP1 upstream homology arm part shall be used together with DPP1 downstream homology arm part (BBa_K3570007) to target a functional yeast integration locus. When DPP1 up put to 5' of the biobrick together with DPP1 downstream to the 3', the biobrick can be integrated into the S. cerevisiae's genome. It will do homologous recombination within the Diacylglycerol pyrophosphate phosphatase 1 (DPP1) gene.

This sequence was identified from a personal communication with Dr. Gilles Truan.

Experiments

We used this part in the insertion of the tHMG1 and CrtE genes (part BBa_K3570000) in the yeast genome. Below is our yeast transformation protocol and our results which show that we have successfully integrated this part and that the BBa_K3570006 and BBa_K3570007 parts work.


A. Protocols


  • Preparation of yeast competent cells

    • Fresh yeast were grown in 25ml of YPD medium overnight. This preculture was diluted to low OD600nm (e.g. 0.05) in 50ml of fresh YPD medium. The biomass concentration was measured every two hours until it reaches an OD600nm of around 0.8. The 50ml of culture was transfered in a 50ml falcon-tube and was centrifuged 5 minutes at 3000rpm at room temperature. The supernatant was removed and 25ml of LiAc/TE was added. The tube had to be thoroughly inverting 10 times. The tube was centrifuged 5 minutes at 3000rpm at room temperature. The supernatante was removed and 400µl of LiAc/TE was added. The tube had to be thoroughly inverting 10 times. Yeast competent cells should be used on the same day that they have been prepared.


  • Yeast transformation

    • A mix in 1.5ml microcentrifuge tube was prepared with 2µl of transforming DNA (BBa_K3570000), 40µl of competente yeast cells , 25µg of carrier DNA (SS-DNA) and 168µl of 50% PEG in 100mM LiAc/TE.
    Positive control was the same mixture but the transforming DNA was replaced by 1uL of pR313. The negative control was the same mixture but had no transforming DNA. After vortexing, the solution was incubated 45 minutes at 30°C. Then 13µl of DMS0 was added and the solution was vortexed again. It was centrifuged at 10,000 rpm for 1 minute. The supernatante was removed and the pellet was resuspended in 80µl of NaCl. The solution was seeded on petri dishe of YNB with all amino acids expect histidine. Our selectable marker was histidine. The petri dishe was incubated at 30°C for three days.


  • Integration verification PCR

    • The integration of BBa_K3570000 using the DPP1 homoly sequence (BBa_K3570006 and BBa_K3570007) was performed by a genomic PCR using the TaKaRa PCR amplification Kit. Our insert was to big to be amplified by PCR. We therefore decided to amplified a part of 1200kb in the genome. The following primers have been used. The primer 1 (forward hybridizes on our selectable marker HIS3 . The primer 2 (reverse) hybridizes on the 1,039,876 pb of the chromosome IV of the strain BY4741 (upstream of the DPP1 gene).


    B. Results and discussion

    Since the construction of the part BBa_K3570000 was successful, we proceeded to the next step: integration in the yeast genome. The plasmid was digested with enzymes SbfI and EcoRI and purified to transform the yeast Saccharomyces cerevisiae resulting in th strain BY4741 DPP::tHMG1-crtE. The yeast was then grown on YNB with all amino acids expect histidine for 3 days. At the third try, we were able to observe around 20 colonies in our yeast transformation, about the same on the positive control and none on the negative control plate. We randomly chose eight clones from our transformation and one from the positive control plate (see on the figure 1 below) for PCR verification integration.

    Figure1: Verification of the integration of the part BBa_K3570000 in the yeast genome using DPP1 homology sequence (BBa_3570006 and BBa_3570007). The expected size is 1.2kb.

    All clones have the expected size (1.2kb), and the control where we inserted pRS313 does not show any band.
    The integration of BBa_K3570000 should results in an increase of the GGPP quantity. For further verification, we analyzed the quantity of GGPP in the strain BY4741 DPP::tHMG1-crtE and in the wild type.


    Figure 2: Results of the GGPP analysis from culture on YNB with 2% Glucose by LC-MS

    According to the figure 2, our strain BY4741 DPP::tHMG1-crtE showed a five-fold increase in GGPP concentration in comparison with the wild type yeast. These two verifications proved that we have successfully integrated tHmg1 and CrtE into the yeast using DPP1 homology sequence!

    References

    • S. cerevisiae genome, chromosome IV, DPP1 gene. GenBank: CP046084.1

    Sequence and Features


    Assembly Compatibility:
    • 10
      INCOMPATIBLE WITH RFC[10]
      Illegal PstI site found at 50
    • 12
      INCOMPATIBLE WITH RFC[12]
      Illegal PstI site found at 50
    • 21
      COMPATIBLE WITH RFC[21]
    • 23
      INCOMPATIBLE WITH RFC[23]
      Illegal PstI site found at 50
    • 25
      INCOMPATIBLE WITH RFC[25]
      Illegal PstI site found at 50
    • 1000
      COMPATIBLE WITH RFC[1000]