Difference between revisions of "Part:BBa K3570006"

Line 66: Line 66:
  
 
<p>Since the construction of the part BBa_K3570000 was successful, we proceeded to the next step: integration in the yeast genome. The plasmid was digested with enzymes <em>Sbf</em>I and <em>EcoR</em>I and purified to transform the yeast Saccharomyces cerevisiae. The yeast was then grown on YNB HIS- for 3 days. At the third try, we were able to observe around 20 colonies in our yeast transformation, about the same on the positive control and none on the negative control plate.</p>
 
<p>Since the construction of the part BBa_K3570000 was successful, we proceeded to the next step: integration in the yeast genome. The plasmid was digested with enzymes <em>Sbf</em>I and <em>EcoR</em>I and purified to transform the yeast Saccharomyces cerevisiae. The yeast was then grown on YNB HIS- for 3 days. At the third try, we were able to observe around 20 colonies in our yeast transformation, about the same on the positive control and none on the negative control plate.</p>
<p>To verify our colonies we performed a genomic PCR using the TaKaRa PCR Amplification Kit using the following primers.We randomly chose eight clones from our transformation and one from the positive control plate (Figure 7).
+
<p>To verify our colonies we performed a genomic PCR using the TaKaRa PCR Amplification Kit using the following primers.We randomly chose eight clones from our transformation and one from the positive control plate (Figure 7).</p>
Primer 1: ATCAGGATTTGCGCCTTT
+
<p> Primer 1: ATCAGGATTTGCGCCTTT</p>
Primer 2: AAGCAGGCCCTTGCACGTCAAG
+
<p>Primer 2: AAGCAGGCCCTTGCACGTCAAG</p>
</p>
+
 
  
 
[[File:T--Toulouse_INSA-UPS--2020_CB-F7.png|500px|thumb|center|Figure 7: Transformation verification: the expected size is 1.2kb.]]
 
[[File:T--Toulouse_INSA-UPS--2020_CB-F7.png|500px|thumb|center|Figure 7: Transformation verification: the expected size is 1.2kb.]]

Revision as of 21:24, 25 October 2020


DPP1 upstream homologous sequence

Usage

DPP1 upstream homology arm part shall be used together with DPP1 downstream homology arm part (BBa_K3570007) to target a functional yeast integration locus. When DPP1 up put to 5' of the biobrick together with DPP1 downstream to the 3', the biobrick can be integrated into the S. cerevisiae's genome. It will do homologous recombination within the Diacylglycerol pyrophosphate phosphatase 1 (DPP1) gene.

This sequence was identified from a personal communication with Dr. Gilles Truan.

Experiments

We used this part in the insertion of the tHMG1 and CrtE genes (part BBa_K3570000) in the yeast genome. Below is our yeast transformation protocol and our results which show that we have successfully integrated this part and that the BBa_K3570006 and BBa_K3570007 parts work.


A. Protocols


1. Preparation of yeast competent cells
- Materials
75 mL of YPD medium.
50mL falcon-tube.
Centrifuge
26mL of LiAc/TE.
- Methods

  • Overnight preculture from a fresh colony of yeast in 25mL of YPD.
  • Dilute overnight precultures to low OD600 (e.g. 0.05) in 50 ml fresh YPD medium.
  • Mesure concentration every 2h to 3h until it reaches an OD of around 0.8.
  • Transfer 50mL to a 50mL falcon-tube and centrifuge 5min at 3000rpm (room-temperature).
  • Remove flow-thru and add 25mL of LiAc/TE, mix thoroughly by inverting the tube 10 times.
  • Centrifuge 5min at 3000rpm (at room-temperature).
  • Remove flow-thru.
  • Add 400uL of LiAc/TE, mix thoroughly by inverting the tube 10 times.
    Yeast competent cells should be used on the same day that they have been prepared.
  • 2. Yeast transformation

    -Materials

    Transforming DNA Competent yeast cells 10mg/ml carrier DNA (SS-DNA) 50% PEG in 100mM LiAc/TE NaCl YNB plates (with all the amino acids except histidine) 30ºC warm bath 42ºC warm bath 30ºC incubator table-top microcentrifuge 1.5mL microcentrifuge tube

    -Method

  • Prepare mix in 1.5mL microcentrifuge tube:
  • T--Toulouse INSA-UPS--2020 CB-F8.png

    Positive control was performed by adding 1uL of pR313 instead of the transforming DNA, and negative control had no DNA.

    1. Vortex solution.
    2. Incubate 45min at 30ºC.
    3. Add 13uL of DMS0 and vortex solution.
    4. Incubate 15min at 42ºC.
    5. Add 450uL of NaCl and vortex solution.
    6. Centrifuge at 10000rpm for 1min.
    7. Remove flowthru and resuspend pellet with 80uL of NaCl.
    8. Plate solution on YNB plates (with all the amino acids except for the ….)
    9. Incubate at 30ºC for two to three days.

    10. B. Results and discussion:


      Since the construction of the part BBa_K3570000 was successful, we proceeded to the next step: integration in the yeast genome. The plasmid was digested with enzymes SbfI and EcoRI and purified to transform the yeast Saccharomyces cerevisiae. The yeast was then grown on YNB HIS- for 3 days. At the third try, we were able to observe around 20 colonies in our yeast transformation, about the same on the positive control and none on the negative control plate.

      To verify our colonies we performed a genomic PCR using the TaKaRa PCR Amplification Kit using the following primers.We randomly chose eight clones from our transformation and one from the positive control plate (Figure 7).

      Primer 1: ATCAGGATTTGCGCCTTT

      Primer 2: AAGCAGGCCCTTGCACGTCAAG


      Figure 7: Transformation verification: the expected size is 1.2kb.

      All clones have the expected size (1.2kb), and the control where we inserted pRS313 does not show any band. We have successfully integrated tHmg1 and CrtE into the yeast using DPP1 homology sequence!

      References

      • S. cerevisiae genome, chromosome IV, DPP1 gene. GenBank: CP046084.1

      Sequence and Features


      Assembly Compatibility:
      • 10
        INCOMPATIBLE WITH RFC[10]
        Illegal PstI site found at 50
      • 12
        INCOMPATIBLE WITH RFC[12]
        Illegal PstI site found at 50
      • 21
        COMPATIBLE WITH RFC[21]
      • 23
        INCOMPATIBLE WITH RFC[23]
        Illegal PstI site found at 50
      • 25
        INCOMPATIBLE WITH RFC[25]
        Illegal PstI site found at 50
      • 1000
        COMPATIBLE WITH RFC[1000]