Difference between revisions of "Part:BBa K863101:Design"
(→References) |
(→References) |
||
Line 21: | Line 21: | ||
===References=== | ===References=== | ||
'''Contribution (Waterloo iGEM 2020)''' | '''Contribution (Waterloo iGEM 2020)''' | ||
− | McLean, B.W., Bray, M.R., Boraston, A.B., Gilkes, N.R., Haynes, C.A., & Kilburn, D.G. (2000). Analysis of binding of the family 2a carbohydrate -binding module from ''Cellulomonas fimi'' xylanase 10A to cellulose: specificity and identification of functionally important amino acid residues. Protein Engineering, 13(11). 801-809. | + | McLean, B.W., Bray, M.R., Boraston, A.B., Gilkes, N.R., Haynes, C.A., & Kilburn, D.G. (2000). Analysis of binding of the family 2a carbohydrate -binding module from ''Cellulomonas fimi'' xylanase 10A to cellulose: specificity and identification of functionally important amino acid residues. ''Protein Engineering'', ''13''(11). 801-809. |
− | Rodriguez, B., Kavoosi, M., Koska, J., Creagh, A.L., Kilburn, D.G., & Haynes, C.A. (2004). Inexpensive and Generic Affinity Purification of Recombinant Proteins Using a Family 2a CBM Fusion Tag. Biotechnology, 20. 1479 - 1489. | + | Rodriguez, B., Kavoosi, M., Koska, J., Creagh, A.L., Kilburn, D.G., & Haynes, C.A. (2004). Inexpensive and Generic Affinity Purification of Recombinant Proteins Using a Family 2a CBM Fusion Tag. ''Biotechnology, 20.'' 1479 - 1489. |
Revision as of 01:42, 21 October 2020
Cellulose binding Domain of Cellulomonas Fimi Exoglucanse (Freiburg-Standard)
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 4
Illegal AgeI site found at 337 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
The sequence starts with the rest of the Freiburg-prefix (ATG and NgoMIV-restriction-site). The A from the startcodon ATG is the last base of the XbaI restriction-site of the Standard 25 Prefix (Read here). I isolated 12 conserved Bases (4 AS) upstream of the cellulose binding domain and 9 bases downstream of the exoglucanase gene and added a short N-terminal (Glycine, Serine) linker. The sequence ends with the AgeI-restriction-site of the Freiburg-Suffix, to make in frame assembly possible.
Primers that were used to make this BioBrick:
CBDcex_Freiburg-Prefix | GCTAGAATTCGCGGCCGCTTCTAGATGGCCGGCGGTCCGGCCGGGTGCCAGGTG |
CBDcex_2AS-Link_Frei | CTGCAGCGGCCGCTACTAGTATTAACCGGTGCTGCCGCCGACCGTGCAGGGCGTGC |
Source
Cloning-Vector with a CBDcex-Barnase fusion-protein
References
Contribution (Waterloo iGEM 2020) McLean, B.W., Bray, M.R., Boraston, A.B., Gilkes, N.R., Haynes, C.A., & Kilburn, D.G. (2000). Analysis of binding of the family 2a carbohydrate -binding module from Cellulomonas fimi xylanase 10A to cellulose: specificity and identification of functionally important amino acid residues. Protein Engineering, 13(11). 801-809.
Rodriguez, B., Kavoosi, M., Koska, J., Creagh, A.L., Kilburn, D.G., & Haynes, C.A. (2004). Inexpensive and Generic Affinity Purification of Recombinant Proteins Using a Family 2a CBM Fusion Tag. Biotechnology, 20. 1479 - 1489.