Difference between revisions of "Part:BBa K103018:Design"
(→Design Notes) |
|||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K103018 short</partinfo> | <partinfo>BBa_K103018 short</partinfo> | ||
Line 7: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
+ | Preparation of BBa_K103018 is in details described [http://2008.igem.org/wiki/index.php?title=Team:Warsaw/JSTest&num=8&arg0=29_September_2008&arg1=30_September_2008&arg2=1_October_2008&arg3=2_October_2008&arg4=6_October_2008&arg5=7_October_2008&arg6=8_October_2008&arg7=9_October_2008&name=Preparation%20of%20OmpA_linker_omega_linker%20under%20Plac%20(BBa_K103018) here] (entries from Univeristy of Warsaw 2008 iGEM team notebook). | ||
+ | OmpA_linker_omega_linker (under control of lactose promoter) fragment was amplified from [http://2008.igem.org/Wiki/Team:Warsaw/vectors/pACYC177%2BompA-omega-A-alpha pACYC177+OmpA-omega-ΔA-alpha] using primers: 5' TAGAATTCGCGGCCGCTTCTAGAGCTGGCACGACAGGTTTCCC 3' and 5' CCACTAGTACCGGATCCCGAACCACCCCCACCCCCGCTAC 3'. Because obtained fragment contains EcoRI site we've developed Przanowski' method for removing of internal restriction site (described below). | ||
− | + | =====Przanowski' method:===== | |
− | + | PCR product were digested overnight with EcoRI. Digested fragment was Klenow-blunted and religated with T4 ligase. Product of ligation (without internal EcoRI site) was PCR amplified using primers listed above, digested with EcoRI and BcuI and ligated into [https://parts.igem.org/wiki/index.php?title=Part:pSB2K3 pSB2K3] | |
===Source=== | ===Source=== |
Revision as of 15:25, 28 October 2008
OmpA_linker_omega_linker under Plac
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1081
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 875
Design Notes
Preparation of BBa_K103018 is in details described [http://2008.igem.org/wiki/index.php?title=Team:Warsaw/JSTest&num=8&arg0=29_September_2008&arg1=30_September_2008&arg2=1_October_2008&arg3=2_October_2008&arg4=6_October_2008&arg5=7_October_2008&arg6=8_October_2008&arg7=9_October_2008&name=Preparation%20of%20OmpA_linker_omega_linker%20under%20Plac%20(BBa_K103018) here] (entries from Univeristy of Warsaw 2008 iGEM team notebook).
OmpA_linker_omega_linker (under control of lactose promoter) fragment was amplified from [http://2008.igem.org/Wiki/Team:Warsaw/vectors/pACYC177%2BompA-omega-A-alpha pACYC177+OmpA-omega-ΔA-alpha] using primers: 5' TAGAATTCGCGGCCGCTTCTAGAGCTGGCACGACAGGTTTCCC 3' and 5' CCACTAGTACCGGATCCCGAACCACCCCCACCCCCGCTAC 3'. Because obtained fragment contains EcoRI site we've developed Przanowski' method for removing of internal restriction site (described below).
Przanowski' method:
PCR product were digested overnight with EcoRI. Digested fragment was Klenow-blunted and religated with T4 ligase. Product of ligation (without internal EcoRI site) was PCR amplified using primers listed above, digested with EcoRI and BcuI and ligated into pSB2K3