Difference between revisions of "Part:BBa K2918039"
(→Usage and Biology) |
(→Strain Construction) |
||
Line 17: | Line 17: | ||
===Strain Construction=== | ===Strain Construction=== | ||
− | The DNA sequence of the part was synthesized by IDT with flanking BsaI sites and 'TACT' and 'GTTT' as 5' and 3' overhangs respectively. The ribozyme was then cloned along with an altered RBS in a level 0 MoClo backbone | + | The DNA sequence of the part was synthesized by IDT with flanking BsaI sites and 'TACT' and 'GTTT' as 5' and 3' overhangs respectively. The ribozyme was then cloned along with an altered RBS in a level 0 MoClo backbone <html><a target="_blank" href="http://www.addgene.org/47992">pICH41246</a></html> and the sequence was confirmed by sequencing. Click <html><a href="http://2019.igem.org/Team:TUDelft/Experiments" target="_blank">here</a></html> for the detailed protocol. |
− | + | ||
− | + | ||
===References=== | ===References=== |
Latest revision as of 19:53, 6 December 2019
SarJ
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
The part has been confirmed by sequencing and has no mutations.
Usage and Biology
Many promoter parts contain sequences downstream of the Transcription Start Site (such as operators or assembly fusion sites) resulting in extra unintended sequences in the transcript. These additional sequences are shown to significantly affect gene expression levels, disrupting the modularity and predictability of synthetic parts (Lou et al., 2012). Therefore, to insulate the translational rates of the part from the use of different promoters, ribozymes can be used for their self-cleavage properties and remove these sequences upstream of mRNA. By the inclusion of ribozymes in 5’ UTR parts, outputs of genetic circuits will be insulated from genetic context, but the presence of multiple copies of the same ribozyme in different genes may result in homologous recombination (Lou et al., 2012). With that in mind, we, from TU Delft 2019, have designed Type IIS parts of both ribozymes and RBS for modular assembly in any combination desired.
Unfortunately, junction sequences such as Type IIS overhangs between ribozyme and RBS can also influence translation rates. To achieve scarless modular cloning of ribozymes and RBS, the strategy illustrated below can be adopted.
Lou et al. have screened and identified a series of ribozymes for insulating genetic circuits. All of these ribozymes contain conserved 3’ ends (ACCTCTACAAATAATTTTGTTTAA). The four highlight nucleotides can be used as a fusion site identified as compatible to Type IIS cloning. In the RBS sequence, AA should be added upstream in order to complement the incomplete ribozyme sequence when assembled.
Strain Construction
The DNA sequence of the part was synthesized by IDT with flanking BsaI sites and 'TACT' and 'GTTT' as 5' and 3' overhangs respectively. The ribozyme was then cloned along with an altered RBS in a level 0 MoClo backbone pICH41246 and the sequence was confirmed by sequencing. Click here for the detailed protocol.
References