Difference between revisions of "Part:BBa K2515002"

Latest revision as of 00:37, 22 October 2019

gRNA expression vector for use with Cas9 or dCas9

This is the pSB1C3-gRNA vector designed and used by Team Bulgaria 2017. Our gRNA cloning cassette consist of four functional regions. First comes the constitutive promoter J23119 with defined transcription start. It is fused to the second base pairing region which itself is surrounded by two unique Eco31I sites. Next comes a gRNA scaffold region followed by a S. pyogenes terminator.

For more details and protocols - see Design page.
For a functional test of cloned gRNAs - see Experience page.

iGEM19_Bulgaria - quantitative experimental characterization data:

We analyzed the cloning of new gRNAs into this vector in a quantifiable way as a part of this year’s competition criteria fulfillment. To do that, we obtained oligos for three different gRNAs from ex-iGEM members from 2017 and used the following scheme:

We prepared DH10B competent cells and tested their efficiency using 300 pg of pSB1C3 (from the iGEM distribution kit). We made three independent measurements and estimated the transformation efficiency to be 4,75 x 10^6 .

We performed 3 separate ligations with each gRNA into BBa_K2515002 (for oligo annealing and ligation protocol see iGEM Bulgaria’s 2017 wiki - section Protocols) and transformed equal amounts into our competent cells. BBa_K2515002 was digested with Eco31I and then split to the 9 ligations to ensure that the vector’s amount was identical in all reactions.

We obtained a large number of colonies for every ligation and then quantified the success ratio of the cloning procedure via colony PCR. For this PCR, we used one of the oligos from the gRNA and another one that anneals to the vector backbone. To obtain quantifiable data, we analyzed 2 separate petri dishes (20 colonies per each) per transformation (2 transformations per gRNA) and the final estimation was that the success ratio was 4,5/40 (gRNA 1); 5,8/40 (gRNA 2) and 3,2/40 (gRNA 3) - these are averaged values for 3 ligations per gRNA.

Because of these low values, we decided to optimize the cloning process by adding a red color-producing cassette between the two Eco31I sites. This cassette was created as a separate BioBrick with the number BBa_ K3208010. Amplifying it with the corresponding primers allowed us to insert it into BBa_K2515002. In this matter, we created an improved version of the vector - part BBa_ K3208012 (see its page for details).

iGEM18_Bulgaria:

We improved the gRNA expression vector pSB1C3-gRNA - part BBa_K2515002 from the Registry. It was originally designed by the iGEM Bulgaria 2017 team for easy cloning and expression of gRNAs in E. coli. Nevertheless, it is a high copy number vector with no easy option for a plasmid curing. To overcome these limitations, we PCR amplified the pSC101-based thermosensitive origin of replication from the pE-FLP vector (Plasmid #45978). Next, we developed an aqua cloning-based approach to substitute the original pSB1C3 origin with this new part. The resulting vector was low copy number (that is sufficient for gRNA expression due to the high efficiencies of the CRISPR/Cas9 systems) and can be eliminated by cultivation at 42oC.

NB! The generated vector is a low copy number plasmid, thus, one needs to use reduced antibiotic concentrations and the colony growth requires more time. In addition, the pSC101 ori contains a SpeI restriction site and, therefore, is not BioBrick RCF10-compatible! If you need to use it – adopt the aqua cloning procedure from the part’s page in the Registry. We submitted a new part BBa_K2847002 – it contains the thermosensitive replication origin and can be used as a template in PCR amplification reactions

Protocol for Aqua cloning based origin replacement:

Primer pair for pSC101* thermosensitive origin amplification

Primer_F: CAGGTTTGTGCCAATACCAG

Primer_R CAGCGATTTGCCCGATTGC

You can use either part BBa_K2847002 or pE-FLP (Addgene Plasmid #45978) as a matrix.

24-bp overhangs for the BioBrick vector backbone amplification

cggccgcaatcgggcaaatcgctg

tctactggtattggcacaaacctg

Next all you have to do is to perform a standard Aqua cloning procedure - for more details you can see doi.org/10.1371/journal.pone.0137652 Have in mind that the new origin will transform your vector in a low copy number one so in many cases you have to reduce the antibiotic concentrations to obtain colonies. Also the colonies growth can take a bit longer since they have to be cultivated at 30oC.

Sequence and Features