Difference between revisions of "Part:BBa K917004:Experience"

Revision as of 00:11, 22 October 2019

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K917004

This biobrick was used for the construction of plac-lacZ-nitroreductase biobrick which puts nitroreductase under the control of the lac promoter(BBa_K917005) https://parts.igem.org/wiki/index.php?title=Part:BBa_K917005

User Reviews

edit by sysu-medicine

CMV promoter + Riboswitch + Nitroreductase + eGFP

Nitroreductase is an enzyme that can catalyze the reduction of nitro aromatic compounds to aromatic amines. In our project we optimized the nitroreductase that we carried out human codon optimization on the original nitro reductase and added flag tag for labeling, which Increases the expression of protein as well as detection . However, in our experiment we gained the result which is opposite to our expectation. There are several reasons we have considered for this result. For the one hand, we are likely to infer that it is possibly a on-switch. On the other hand, we also consider that maybe the insert of riboswitch has an influence on the expression of its downstream sequence, or there are more segments required for the expression of its downstream sequence. However, one thing we can sure is that the riboswitch did have the control function, and there are still many questions waiting for further exploration. The CMV promoter(BBa_I712004)+ Riboswitches(BBa_k2942701)+Nitroreductase(BBa_k2942703)+eGFP(BBa_I914891)was linked into the expression vector by restriction sites EcoRI and PstI, and the correct construction of this recombinant plasmid was confirmed by PCR identification(Fig.1), sequencing of the recombinant plasmid (Fig.2). The expression of nitroreductase can be indirectly refleted by observing the fluorescence(Fig.3) which was quantified using Image J(Fig.4)and directly seen using western blot(Fig.5). The activity of the nitroreductase which can turn the prodrug to the chemicals killing cells are assessed by measuring the survival rate of the cells (Fig.6).

Primers for homologous recombination:

PSBA3-F AACTGCAGTCCGGCAAAAAAGGGCAAG

PSBA3-R CGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGG

CMV-F TAAGGATGATTTCTGGAATTCGTGATGCGGTTTTGGCAGT

CMVR-RIBO-R CGGTGACAGCTTTGTTTGTTTAGCTCTGCTTATATAAACCTCC

RIBOF AAACAAACAAAGCTGTCACCGGATGTGC

RIBO-GFP-R CTCCTCGCCCTTGCTCACCATGTTTTTATTTTTCTTTTTGC

NR-F ATGGACATCATCTCCGTGGCCCTGAAGC

FLAG-R CTCCTCGCCCTTGCTCACCATCTTATCGTCATCGTCTTTGTA

GFPF ATGGTGAGCAAGGGCGAGGAGCTGT

GFPR CCTTTTTTGCCGGACTGCAGCTTGTACAGCTCGTCCATG

Primers for PCR:

F TTCGCTAAGGATGATTTCTGGAATTC

R CCTTTTTTGCCGGACTGCAGCTTGTACAGCTCGTCCATG

Primers for sequencing:

F TTCGCTAAGGATGATTTCTGGAATTC

R CTTGTACAGCTCGTCCATG

Fig.1 PCR result. We extracted plasmids from the bacteria solution which shows correct sequencing result, and 1%agarose gel electrophoresis was performed to validate the PCR production of the fusion segment that has inserted between the restriction sites EcoRI and PstI. The primers for PCR are as above.

Fig.2 Sequencing result of the recombinant plasmid. The primers for sequencing are as above. You can click here to download the sequence files.

Fig.3 Transfection cells observed under a fluorescence microscope. 293T cells were seeded 7.5×105 per well in the 6 well plate, and transfection was performed following the protocol of Invitrogen Lipofectamine™ 3000 Transfection Reagent when cells grow to 70-80% of the wells. We added 4mM theophylline (solved in PBS) into the experimental group according to the Bell’s article [1] while equivoluminal PBS to control group 4h after transfection. the Fluorescence was observed 24h after the transfection.

Fig.4 Fluorescent quantitation by Image J(P<0.001).

Fig.5 Western blot result. 2×SDS was used to lyse cells when fluorescence 80% of cells can be een with fluorescence.12% SDS-PAGE was used for electrophoresis of denatured protein, and then Millipore Immobilon PVDF membrance (0.45um) was used for following immunoraction(using SIGMA Monoclonal ANTI-FLAG®BioM2−Biotin, Clone M2) and chemiluminescence reaction.

Fig.6 Survival rate of cells. 293T cells were seeded 104 per well in the 96 well plate, and CB1954(10 Um, see the reaction principle in Fig.6) and theophylline(4 mM) were added 8h after transfection. The survival rate of cells was examined using MTT Cell Proliferation and Cytotoxicity Assay Kit. Obvious killing effect was examined comparing with control group(P<0.05).

Fig.7 The principle of reaction between CB1954 and nitroreductase. Elsie M. Williams, et al. Nitroreductase gene-directed enzyme prodrug therapy: insights and advances toward clinical utility. Biochem J 15 October 2015; 471 (2): 131–153.

[1] Bell, C.L., et al., Control of alphavirus-based gene expression using engineered riboswitches. Virology, 2015. 483: p. 302-311.

In conclusion, this result well confirmed that nitroreductase transformant certainly turn the prodrug to the effective chemicals. This part is also a improvement of BBa_K917004

UNIQ1d519500499a4352-partinfo-00000000-QINU UNIQ1d519500499a4352-partinfo-00000001-QINU