Difference between revisions of "Part:BBa K103003:Design"
(→Design Notes) |
|||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K103003 short</partinfo> | <partinfo>BBa_K103003 short</partinfo> | ||
Line 7: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
+ | <html> | ||
+ | B Domain of Staphylococcal protein A was incidentally amplified from vector carrying full protein A sequnce using primers AP+NotI (5' AA GCGGCCGC C GGTTGACTTCCCCGCGGAATTC 3') and AL+link10+homo2 (5' TCTGGAGGTGGAGGTAGCGG GGGTGGGGGTGGTTCGGGTGGAGGTGGT AAAACCGCGGCTCTTGCGC 3'). This primers should be able to generate both: full-length protein A-coding sequence and only B-domain coding sequence.<br><br> | ||
+ | Resulting fragment - B Domain of Staphylococcal protein A was cloned into into pACYC177 vector to generate <a href=http://2008.igem.org/Wiki/Team:Warsaw/vectors/pACYC177%2BompA-omega-A-alpha>pACYC177+OmpA-omega-ΔA-alpha</a> vector, used by our team in 'hunter and prey' tests. <br><br> | ||
+ | BBa K103003 part was prepared by PCR on <a href=http://2008.igem.org/Wiki/Team:Warsaw/vectors/pACYC177%2BompA-omega-A-alpha>pACYC177+OmpA-omega-ΔA-alpha</a> vector using AL_BXNE (5' TAGAATTCGCGGCCGCTTCTAGAGGGCATATGGGATCCAAAACCGCGGCTCTTGCGCAAC 3') and APSacSpe (5' GGACTAGTAGAGCTCCCGTCTACTTTCGGCGCCTGAGC 3') primers, followed by digestion with EcoRI and BcuI | ||
− | + | </html> | |
− | + | ||
− | + | ||
===Source=== | ===Source=== |
Revision as of 21:33, 26 October 2008
B domain of Staphylococcal protein A
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 91
Illegal BamHI site found at 9 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
B Domain of Staphylococcal protein A was incidentally amplified from vector carrying full protein A sequnce using primers AP+NotI (5' AA GCGGCCGC C GGTTGACTTCCCCGCGGAATTC 3') and AL+link10+homo2 (5' TCTGGAGGTGGAGGTAGCGG GGGTGGGGGTGGTTCGGGTGGAGGTGGT AAAACCGCGGCTCTTGCGC 3'). This primers should be able to generate both: full-length protein A-coding sequence and only B-domain coding sequence.
Resulting fragment - B Domain of Staphylococcal protein A was cloned into into pACYC177 vector to generate pACYC177+OmpA-omega-ΔA-alpha vector, used by our team in 'hunter and prey' tests.
BBa K103003 part was prepared by PCR on pACYC177+OmpA-omega-ΔA-alpha vector using AL_BXNE (5' TAGAATTCGCGGCCGCTTCTAGAGGGCATATGGGATCCAAAACCGCGGCTCTTGCGCAAC 3') and APSacSpe (5' GGACTAGTAGAGCTCCCGTCTACTTTCGGCGCCTGAGC 3') primers, followed by digestion with EcoRI and BcuI