Difference between revisions of "Part:BBa K2924014"
Line 47: | Line 47: | ||
<html><p align="justify"> </html> | <html><p align="justify"> </html> | ||
As in Fig. 5 can be seen, the overall fluorescence decreased after induction with the inducer aTc. But in comparison to the empty vector control (EVC), fluorescence can be clearly measured. This proves our concept of down-regulating a protein or enzyme without abolishing the functions completely. | As in Fig. 5 can be seen, the overall fluorescence decreased after induction with the inducer aTc. But in comparison to the empty vector control (EVC), fluorescence can be clearly measured. This proves our concept of down-regulating a protein or enzyme without abolishing the functions completely. | ||
− | + | <br><br><br><br><br><br><br><br><br><br><br><br> | |
====Confocal Imaging==== | ====Confocal Imaging==== | ||
Revision as of 13:41, 20 October 2019
guideRNA from mVenus
mVenus guide RNA
Usage and Biology
This part contains guide RNA of mVenus, a fluorescent protein, which originates from Aequorea victoria and is an improved variant of YFP, which folds faster and more efficiently 1. It was used for an induced knock-down with a CRISPRi/dCas9-system, which was kindly provided by Yao et al. (2015)2. The guide RNA was obtained by using the CRISPR guide from benchling3. The sgRNA in the gene is located at 52-71 bp in the + strand (Fig. 1). The sequence of the sgRNA is GAATTGGATGGTGATGTGAA has anOn-Target Score of 70.2 and an Off-Target Score of 100.0.
The mVenus sgRNA was cloned into a vector containing a neutral site of Synechocystis sp. PCC 6803. That’s a homologous sequence of its genome to ensure a knock-in into the genome (Fig.. 2)2.
Due to this knock-in containing a resistance for antibiotic and the sgRNA, we can down-regulate the target enzyme with a CRISPRi/dCas9 - system2. This system is induced by anhydrotetracycline (aTc), which activates the synthesis of the dCas9, which is then binding to the sgRNA. These complex is able to bind complementary to the targeted enzyme and stops the transcription of it (Fig. 3).
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Characterization
The sgRNA was designed using the “CRISPR Guides” tool on benchling 3 by choosing suitable candidate sgRNAs, which binds at the start of mVenus and cloned it via homologous recombination into the genome of Synechocystis sp. PCC 6803. Furthermore, this Synechocystis sp. PCC 6803 was transformed with a plasmid containing thePcpc560 (BBa_K2924000) and the mVenus CDS (BBa_K2924035).
Effect of inducible CRISPRi/dCas9 over time
For testing the effect of CRISPRi/dCas9 and its active time, Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_Pcpc560_mVenus colonies were inoculated in BG11 medium with 20 µg/ml spectinomycin, 25 µg/ml kanamycin and 10 µg/ml chloramphenicol at 30°C and shaked with specific light and CO2 conditions. After a few days, the cultures were diluted to an OD750 of 0.4. The fluorescence has been tested for two days by matching the OD750 of the cultures to 0.4, for more consisting results, and the fluorescence was measured at λex/em = 511 nm/ 552 nm (Fig. 4).
The optimal activity, and therefore the lowest measured fluorescence, of the dCas9 was measured after 24 h after the induction with 500 nM aTc (Fig. 4). To keep the expression of the gene low further induction with aTc might be necessary.
Synechocystis sp. WT and Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_Pcpc560_mVenus colonies were inoculated in BG11 medium with 20 µg/ml spectinomycin, 25 µg/ml kanamycin and 10 µg/ml chloramphenicol at 30°C and shaked with specific light and CO2 conditions using 6 well plates. After 2 days of incubation, some cultures were induced with 500 nM aTc or with 100% EtOH as a control with the same amounts added. After 24 hours, the fluorescences were measured using a plate reader. Each sample was measured in biological duplicates, which are then tested in technically triplicates (Fig. 5).
As in Fig. 5 can be seen, the overall fluorescence decreased after induction with the inducer aTc. But in comparison to the empty vector control (EVC), fluorescence can be clearly measured. This proves our concept of down-regulating a protein or enzyme without abolishing the functions completely.
Confocal Imaging
Synechocystis sp. PCC 6803 with sgRNA_mVenus and pSHDY_Pcpc560_mVenus and Synechocystis sp. PCC 6803 with pSHDY_Pcpc560_mVenus cultures were diluted to an OD750 of 0.2 and induced with an appropriate amount of 500 nM aTc. As indicated in Figure 4 the highest dCas activity is detected after ca. 24h, because of this 1 ml culture were taken after exact 24 hours. These samples were diluted to 1:10 and observed with a confocal microscope (Fig. 6).
![](/wiki/images/9/90/MVenus_microscopy.png)
As shown in Fig. 5, when the culture ist induced with 500 nM aTc, there is a overall lower fluorescence as in the control culture. Against the expectation, that this may be due to a gradual knockdown, it is more like a “Knock on or off”-system, as seen in Fig. 6. Most of the induced cells are showing no evidence of mVenus fluorescence (Fig. 6, D), a few of them show fluorescence which does not differ in fluorescence compared to the fluorescence of the control strain (Fig. 6, C).
References
[1]: Kremers, G. J., Goedhart, J., van Munster, E. B., & Gadella, T. W. (2006). Cyan and yellow super fluorescent proteins with improved brightness, protein folding, and FRET Förster radius. Biochemistry, 45(21), 6570-6580.
[2]:Yao, L., Cengic, I., Anfelt, J., & Hudson, E. P. (2015). Multiple gene repression in cyanobacteria using CRISPRi. ACS synthetic biology, 5(3), 207-212.
[3]: Benchling [Biology Software]. (2019). Retrieved from https://benchling.com.